CoChat
Sign Up
Cited by 250Metabolism, Diabetes, and CancerMuscle Physiology and DisordersAdipose Tissue and Metabolism

Signaling Specificity of Interleukin-6 Action on Glucose and Lipid Metabolism in Skeletal Muscle

Open access
Al-Khalili, Lubna, Bouzakri, Karim, Glund, Stephan, Lönnqvist, Fredrik, Koistinen, Heikki A., Krook, Anna·2006·Molecular Endocrinology
DOI 10.1210/me.2005-0490
Open this paper in CoChat — free accountOpen PDF

Abstract

We identified signaling pathways by which IL-6 regulates skeletal muscle differentiation and metabolism. Primary human skeletal muscle cells were exposed to IL-6 (25 ng/ml either acutely or for several days), and small interfering RNA gene silencing was applied to measure glucose and fat metabolism. Chronic IL-6 exposure increased myotube fusion and formation and the mRNA expression of glucose transporter 4, peroxisome proliferator activated receptor (PPAR)α, PPARδ, PPARγ, PPARγ coactivator 1, glycogen synthase, myocyte enhancer factor 2D, uncoupling protein 2, fatty acid transporter 4, and IL-6 (P < 0.05), whereas glucose transporter 1, CCAAT/enhancer-binding protein-α, and uncoupling protein 3 were decreased. IL-6 increased glucose incorporation into glycogen, glucose uptake, lactate production, and fatty acid uptake and oxidation, concomitant with increased phosphorylation of AMP-activated protein kinase (AMPK), signal transducer and activator of transcription 3, and ERK1/2. IL-6 also increased phosphatidylinositol (PI) 3-kinase activity (450%; P < 0.05), which was blunted by subsequent insulin-stimulation (P < 0.05). IL-6-mediated glucose metabolism was suppressed, but lipid metabolism was unaltered, by inhibition of PI3-kinase with LY294002. The small interfering RNA-directed depletion of AMPK reduced IL-6-mediated fatty acid oxidation and palmitate uptake but did not reduce glycogen synthesis. In summary, IL-6 increases glycogen synthesis via a PI3-kinase-dependent mechanism and enhances lipid oxidation via an AMPK-dependent mechanism in skeletal muscle. Thus, IL-6 directly promotes skeletal muscle differentiation and regulates muscle substrate utilization, promoting glycogen storage and lipid oxidation.

AI snapshot

Written from the paper’s full text.

TL;DR

In primary human skeletal muscle cultures, IL-6 directly promotes myotube differentiation and shifts substrate metabolism toward glycogen storage and lipid oxidation. IL-6 increases glycogen synthesis via a PI3-kinase-dependent mechanism and enhances fatty acid uptake/oxidation via an AMPK-dependent mechanism.

Key findings

  • Chronic IL-6 (25 ng/ml, 8 d) increased myotube formation/fusion (15 ± 4% over basal, myotubes with >5 nuclei) and increased mRNA expression of GLUT4, PPARα, PPARδ, PPARγ, PGC1α, glycogen synthase, MEF2D, UCP2, FATP4, and IL-6 (P < 0.05), while decreasing GLUT1, CEBPα, and UCP3 (P < 0.05).
  • IL-6 increased glucose incorporation into glycogen approximately 1.5-fold acutely (3 h) and approximately 2-fold after 8 d (P < 0.05); it also increased glucose uptake, lactate production, and palmitate uptake and oxidation 2.5-fold (P < 0.05). Insulin reduced palmitate oxidation 20% (P < 0.05).
  • IL-6 increased IRS1-associated PI3-kinase activity 4.5-fold (450%; P < 0.05), which was blunted by subsequent insulin. LY294002 prevented IL-6-stimulated glycogen synthesis but did not alter β-oxidation. IL-6 increased AMPK phosphorylation 3.8-fold (P < 0.05); AMPK α-subunit siRNA reduced IL-6-mediated fatty acid uptake and oxidation but did not affect glycogen synthesis.
  • IL-6 increased STAT3 phosphorylation, peaking at 20 min, and increased ERK1/2 phosphorylation; it weakly increased AKT/PKB Thr308 phosphorylation 15% and Ser473 phosphorylation 20% (P < 0.05). Insulin, but not IL-6, increased AS160 and IRS1 Ser312 phosphorylation.

Methods

  • Primary human skeletal muscle cells were obtained from muscle biopsies of seven subjects (four male, three female; mean age 52.5 ± 8 yr, BMI 25.3 ± 3.0 kg/m², fasting blood glucose 5.6 ± 0.5 mM). Differentiated myotubes were treated with IL-6 (5, 25, or 100 ng/ml) acutely (20 min or 3 h) or for 8 d, with or without insulin (6 or 60 nM).
  • Metabolic assays included 14C-glucose incorporation into glycogen, 2-deoxy-[3H]glucose uptake, lactate production, [1-14C]palmitate or oleate oxidation and intracellular labeled palmitate accumulation, Western blot phosphorylation analysis, IRS1-associated PI3-kinase activity, real-time PCR, and Giemsa/Wright staining for myotube formation.
  • AMPK α1/α2 were silenced by siRNA in differentiated myotubes; PI3-kinase was inhibited with LY294002 (10 µM). Data are mean ± SEM, analyzed by Student’s t test or ANOVA with Fisher’s least significant difference post hoc test.

Limitations

  • The paper does not include a dedicated limitations section; stated limitations: Not stated in the paper.
  • Evident from the text: findings are from in vitro primary human skeletal muscle cell cultures, and the paper notes unresolved/divergent in vivo effects of IL-6 on glucose metabolism in humans and rodents.
  • Evident from the text: several experiments used small sample sizes (n = 4–6 subjects/experiments), some results are reported as “data not shown,” and AMPK α1 siRNA also silenced the α2 isoform, limiting isoform-specific conclusions.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1210/me.2005-0490

Cites

72 of 72 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

0 of 22 cited sources checked · 0 supported · 0 flagged

  • Findingown data

    IL-6 exposure for 8 d increased mRNA expression of GLUT4 in primary human skeletal muscle cultures.

    “IL-6 exposure for 8 d increased mRNA expression of glucose transporter (GLUT)4, peroxisome proliferator activated receptor (PPAR)␣, PPAR␦, PPAR␥, PPAR␥ coactivator 1 (PGC1)␣, glycogen synthase, myocyte enhancer factor 2D (MEF2D), uncoupling protein (UCP)2, fatty acid transporter 4, and IL-6 itself (P Ͻ 0.05).”
    Quote in the paperSubstantial claim
  • Findingown data

    IL-6 exposure for 8 d increased mRNA expression of IL-6 itself in primary human skeletal muscle cultures.

    “IL-6 exposure for 8 d increased mRNA expression of glucose transporter (GLUT)4, peroxisome proliferator activated receptor (PPAR)␣, PPAR␦, PPAR␥, PPAR␥ coactivator 1 (PGC1)␣, glycogen synthase, myocyte enhancer factor 2D (MEF2D), uncoupling protein (UCP)2, fatty acid transporter 4, and IL-6 itself (P Ͻ 0.05).”
    Quote in the paperNot a substantial claim
  • Findingown data

    Insulin increased PI3-kinase activity 2-fold in primary human skeletal muscle cells.

    “Insulin increased PI3-kinase activity 2-fold (P Ͻ 0.05; Fig. 5B).”
    Quote in the paperNot a substantial claim
  • Findingown data

    Insulin did not increase phosphorylation of STAT3 in differentiated primary human skeletal muscle cultures.

    “Insulin did not increase phosphorylation of STAT3.”
    Quote in the paperSubstantial claim
  • Findingown data

    IL-6 induced a weak 15% increase in AKT/PKB Thr 308 phosphorylation in differentiated primary human skeletal muscle cultures.

    “IL-6 induced a weak (15%; P Ͻ 0.05; Fig. 4c), although detectable, increase in AKT/ PKB Thr 308 phosphorylation.”
    Quote in the paperSubstantial claim
  • May combine two claims. 16
  • The quote only partly states this claim. 2
  • Classified as probably not a substantial claim. 10

  • May combine two claims.

    Findingown data

    Twenty minutes of IL-6 exposure increased PI3-kinase activity approximately 3-fold in primary human skeletal muscle cells, and this activation was reduced at longer exposures.

    “Twenty minutes of IL-6 exposure increased PI3kinase activity approximately 3-fold (P Ͻ 0.05; Fig. 5A), and this activation was reduced at longer exposures.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    IL-6 potently increased lactate production in primary differentiated human skeletal muscle cultures, although the magnitude of this increase was less than that observed with insulin.

    “IL-6 also potently increased lactate production, although the magnitude of this increase was less than that observed with insulin.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    IL-6 increased phosphorylation of STAT3 in differentiated primary human skeletal muscle cultures, with phosphorylation peaking at 20 min and returning to basal levels after 3 h.

    “IL-6 increased phosphorylation of signal transducer and activator of transcription (STAT)3, with phosphorylation peaking at 20 min and returning to basal levels after 3 h (Fig. 4a).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Insulin and IL-6 independently increased ERK1 and ERK2 phosphorylation in primary human skeletal muscle cultures, and combined exposure showed a trend toward an additive effect.

    “Insulin and IL-6 independently increased ERK1 and ERK2 phosphorylation, and a combined exposure to insulin and IL-6 showed a trend toward an additive effect (Fig. 4g).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Insulin, but not IL-6, increased phosphorylation of the AKT substrate AS160 in primary human skeletal muscle cultures.

    “Insulin, but not IL-6, increased phosphorylation of the AKT substrate AS160 (Fig. 4e).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    IL-6 increased glucose incorporation into glycogen approximately 1.5-fold in primary skeletal muscle cultures, with no dose-response effect noted.

    “IL-6 increased glucose incorporation into glycogen approximately 1.5-fold (P Ͻ 0.05), with no dose-response effect noted (Fig. 1A).”
    Quote in the paperSubstantial claim

  • The quote only partly states this claim.

    Findingown data

    After 8 d of IL-6 (25 ng/ml) exposure, MEF2D mRNA expression in primary human skeletal muscle cultures was 122 ± 1% of untreated cultures (P < 0.05).

    “MEF2D | 122 Ϯ 1 a”
    • Also stated in: § GCCAACCCACCCAAAGCT AAACATGCCCAGTGCCCCAGG CCGCACCTCCTCCTCTTCT · plain
      “a P Ͻ 0.05 compared with untreated cells.”
    Quote in the paperNot a substantial claim

  • The quote only partly states this claim.

    Findingown data

    After 8 d of IL-6 (25 ng/ml) exposure, PPARγ mRNA expression in primary human skeletal muscle cultures was 156 ± 6% of untreated cultures (P < 0.05).

    “PPAR␥ | 156 Ϯ 6 a”
    • Also stated in: § GCCAACCCACCCAAAGCT AAACATGCCCAGTGCCCCAGG CCGCACCTCCTCCTCTTCT · plain
      “a P Ͻ 0.05 compared with untreated cells.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Study design and conductown data

    Sequences targeted at AMPK α2 specifically reduced α2 but not α1 RNA and protein.

    “Sequences targeted at AMPK ␣2 specifically reduced ␣2 but not ␣1 RNA and protein.”
    Quote in the paperSubstantial claim

  • Classified as probably not a substantial claim.

    Study design and conductnone given

    Target sequences were aligned to the human genome database in a BLAST search to eliminate sequences with significant homology to other genes.

    “Target sequences were aligned to the human genome database in a BLAST search to eliminate sequences with significant homology to other genes.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    The 18s gene levels showed least variation between different conditions compared to β2-microglobulin and glyceraldehyde-3-phosphate dehydrogenase.

    “Two other housekeeping genes (␤2-microglubolin and glyceraldehyde-3phosphate dehydrogenase) were also assessed, but the 18s gene levels showed least variation between different conditions.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Premisecitation

    Signal transduction via AMPK plays an important role in stimulation of skeletal muscle fatty acid oxidation and muscle glucose uptake.

    “AMPK is expressed in most mammalian tissues (39,40), and signal transduction via this pathway plays an important role in stimulation of skeletal muscle fatty acid oxidation and muscle glucose uptake (40)(41)(42).”
    Quote in the paperSubstantial claim0 of 3 sources checked
    • cites [40] Winder, 1999, AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes., Am J Physiol

      Not checked in the free run.

    • cites [41] Barnes, 2002, Isoform-specific regulation of 5′ AMP-activated protein kinase in skeletal muscle from obese Zucker (fa/fa) rats in response to contraction., Diabetes source

      Not checked in the free run.

    • cites [42] Kemp, 1999, Dealing with energy demand: the AMP-activated protein kinase., Trends Biochem Sci source

      Not checked in the free run.

  • May combine two claims.

    Premisecitation

    Targeted over-expression of IL-6 increases the extent of myogenic differentiation and myotube development in C2C12 cells, and this effect is reduced by depletion of IL-6 using small interfering RNA (siRNA).

    “Targeted over-expression of IL-6 increases the extent of myogenic differentiation and myotube development in C2C12 cells and this effect is reduced by depletion of IL-6 using small interfering RNA (siRNA) (16).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [16] Baeza-Raja, 2004, p38 MAPK-induced nuclear factor-κB activity is required for skeletal muscle differentiation: role of interleukin-6., Mol Biol Cell source

      Not checked in the free run.

  • May combine two claims.

    Interpretationown data

    IL-6 is a potent mediator of metabolism in skeletal muscle by directly promoting skeletal muscle differentiation and regulating substrate utilization to promote glycogen storage and lipid oxidation.

    “Thus, IL-6 is a potent mediator of metabolism in skeletal muscle by directly promoting skeletal muscle differentiation and regulating substrate utilization to promote glycogen storage and lipid oxidation.”
    Quote in the paperSubstantial claim
    • Rests on an assumption: Primary human skeletal muscle cell cultures are a valid model for skeletal muscle metabolism in vivo.

  • May combine two claims.

    Interpretationown data

    Compared with insulin, the IL-6-mediated increase in production of lactate is approximately 50% reduced, suggesting that, in response to IL-6, skeletal muscle shifts substrate utilization toward a more glucose sparing phenotype.

    “Compared with insulin, the IL-6-mediated increase in production of lactate is approximately 50% reduced, suggesting that, in response to IL-6, skeletal muscle shifts substrate utilization toward a more glucose sparing phenotype.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Premisecitation

    In vivo experiments in humans indicate that IL-6 infusion stimulates lipolysis and rates of whole-body fat oxidation.

    “In vivo experiments in humans indicates that IL-6 infusion stimulates lipolysis and rates of whole-body fat oxidation(36), suggesting that IL-6 is a regulator of whole-body lipid metabolism.”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [36] van Hall, 2003, Interleukin-6 stimulates lipolysis and fat oxidation in humans., J Clin Endocrinol Metab source

      Not checked in the free run.

  • May combine two claims.

    Interpretationown data

    The magnitude of the IL-6-mediated increase in β-oxidation was similar after acute and long-term IL-6 exposure and, thus, was independent of changes in gene expression.

    “However, the magnitude of the IL-6-mediated increase in ␤-oxidation was similar after acute and long-term IL-6 exposure and, thus, was independent of changes in gene expression.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Interpretationown data

    IL-6 increases glycogen synthesis via a PI3-kinase-dependent mechanism and enhances lipid oxidation via an AMPK-dependent mechanism in skeletal muscle.

    “In summary, IL-6 increases glycogen synthesis via a PI3-kinase-dependent mechanism and enhances lipid oxidation via an AMPK-dependent mechanism in skeletal muscle.”
    Quote in the paperSubstantial claim
    • Rests on an assumption: Silencing AMPK α-subunits by siRNA specifically reduces AMPK without off-target effects on other pathways.
    • Rests on an assumption: LY294002 specifically inhibits PI3-kinase without affecting other pathways relevant to IL-6-mediated glycogen synthesis.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    AMPK is a critical regulator of glucose and fat metabolism in skeletal muscle during exercise.

    “Furthermore, AMPK is a critical regulator of glucose and fat metabolism in skeletal muscle during exercise (38,45).”
    Quote in the paperNot a substantial claim0 of 2 sources checked
    • cites [38] Winder, 2001, Energy-sensing and signaling by AMP-activated protein kinase in skeletal muscle., J Appl Physiol source

      Not checked in the free run.

    • cites [45] Musi, 2002, Metformin increases AMP-activated protein kinase activity in skeletal muscle of subjects with type 2 diabetes., Diabetes source

      Not checked in the free run.

  • May combine two claims.

    Interpretationreasoning

    IL-6 appears to mediate effects on mRNA expression via at least two separate signaling pathways, one dependent on AMP kinase and one possibly dependent on PI3-kinase.

    “Thus, IL-6 appears to mediate effects on mRNA expression via at least two separate signaling pathways, one dependent on AMP kinase and one possibly dependent on PI3-kinase.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Interpretationown data

    IL-6 directly promotes skeletal muscle differentiation and regulates muscle substrate utilization, promoting glycogen storage and lipid oxidation.

    “Thus, IL-6 directly promotes skeletal muscle differentiation and regulates muscle substrate utilization, promoting glycogen storage and lipid oxidation.”
    Quote in the paperSubstantial claim
    • Rests on an assumption: Primary human skeletal muscle cell cultures are a valid model for skeletal muscle metabolism in vivo.

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisecitation

    IL-6 infusion in mice reduces the effect of insulin to suppress hepatic glucose output and reduces insulin-stimulated skeletal muscle glucose uptake.

    “IL-6 infusion in mice has been reported to reduce the effect of insulin to suppress hepatic glucose output and reduce insulin-stimulated skeletal muscle glucose uptake (32), whereas others report no effect of IL-6 on whole-body glucose disposal (33).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [32] Kim, 2004, Differential effects of interleukin-6 and -10 on skeletal muscle and liver insulin action in vivo., Diabetes source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Others report no effect of IL-6 on whole-body glucose disposal.

    “IL-6 infusion in mice has been reported to reduce the effect of insulin to suppress hepatic glucose output and reduce insulin-stimulated skeletal muscle glucose uptake (32), whereas others report no effect of IL-6 on whole-body glucose disposal (33).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [33] Rotter Sopasakis, 2004, Short-term infusion of interleukin-6 does not induce insulin resistance in vivo or impair insulin signalling in rats., Diabetologia source

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    IL-6 is a proinflammatory cytokine generally believed to promote insulin resistance.

    “IL-6 is a proinflammatory cytokine generally believed to promote insulin resistance (46).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [46] Lazar, 2005, Evaluation of viral replication in children with chronic hepatitis B with and without interferon treatment., Rom J Gastroenterol

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Correlative evidence links elevated IL-6 levels with the development of insulin resistance in obesity and diabetes mellitus.

    “Correlative evidence links elevated IL-6 levels with the development of insulin resistance in obesity and diabetes mellitus (24).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [24] Sharma, 2005, Obesity, hypertension and insulin resistance., Acta Diabetologica source

      Not checked in the free run.

  • Classified as probably not a substantial claim.

    Premisecitation

    AMPK is a key enzyme involved in the activation of acetyl-coenzyme A carboxylase and lipid oxidation.

    “In rodents, IL-6 has also been shown to activate AMP-activated protein kinase (AMPK) (37), a key enzyme involved in the activation of acetyl-coenzyme A carboxylase and lipid oxidation (38).”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [38] Winder, 2001, Energy-sensing and signaling by AMP-activated protein kinase in skeletal muscle., J Appl Physiol source

      Not checked in the free run.

  • Classified as probably not a substantial claim.

    Premisecitation

    Activation of AMPK mediates insulin-independent stimulation of glucose uptake in resting skeletal muscle.

    “Activation of AMPK mediates insulinindependent stimulation of glucose uptake in resting skeletal muscle (43,44).”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites [43] Jessen, 2003, Effects of AICAR and exercise on insulin-stimulated glucose uptake, signaling, and GLUT-4 content in rat muscles., J Appl Physiol source

      Not checked in the free run.

    • cites [44] Kurth-Kraczek, 1999, 5′ AMP-activated protein kinase activation causes GLUT4 translocation in skeletal muscle., Diabetes source

      Not checked in the free run.

27 of 27

  • The paper relies on this without support.

    Primary human skeletal muscle cell cultures are a valid model for skeletal muscle metabolism in vivo.

    “Here we show that, in primary cultures of human skeletal muscle, IL-6 exposure increases differentiation and myotube formation.”
    “Thus, IL-6 directly promotes skeletal muscle differentiation and regulates muscle substrate utilization, promoting glycogen storage and lipid oxidation.”

  • The paper relies on this without support.

    Silencing AMPK α-subunits by siRNA specifically reduces AMPK without off-target effects on other pathways.

    “Sequences targeted at AMPK ␣1 silenced the ␣1and ␣2-isoform, as evidenced by protein and mRNA expression analysis (Fig. 7).”

  • The paper relies on this without support.

    LY294002 specifically inhibits PI3-kinase without affecting other pathways relevant to IL-6-mediated glycogen synthesis.

    “The effect of IL-6 on glucose incorporation into glycogen was prevented in the presence of LY294002 (Fig. 6).”

  • The paper relies on this without support.

    The IL-6 concentrations used (25 ng/ml and others) are physiologically relevant to in vivo exercise conditions.

    “Primary human skeletal muscle cells were exposed to IL-6 (25 ng/ml either acutely or for several days), and small interfering RNA gene silencing was applied to measure glucose and fat metabolism.”
4 of 4

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

  • IL-6 is additive to insulin in stimulating glucose uptake, but this was not observed by all studies.

    “Their study and Geiger et al. [164] also suggested that IL-6 is additive to insulin in stimulating glucose uptake; however, this was not observed by all studies [165] who found that IL-6 regulated glucose uptake and glycogen synthesis via a PI3-dependent pathway and not AMPK; given human myotubes targeted for AMPK depletion by siRNA did not have impaired insulin sensitivity.”

    From AMPK and Exercise: Glucose Uptake and Insulin Sensitivity (2013) · cites this paper as [165]

  • Accumulating data suggest that IL-6 enhances glucose uptake in myocytes.

    “Thus, accumulating data suggest that IL-6 enhances glucose uptake in myocytes [54–57].”

    From Exercise as a Mean to Control Low‐Grade Systemic Inflammation (2008) · cites this paper as [57]

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

Each contradiction between two passages listed here was confirmed by an independent check.

  • siRNA experiment days do not match the stated transfection schedule

    Minor

    The methods say myotubes were transfected on differentiation day 2 and used four days later, which would be day 6. Figure 7 instead identifies the assayed myotubes as day 4; Figure 8 identifies them as day 5.

1 of 1

Cites

Flagged first, then by citations

Cited by

Sorted by citations

Related

Authors
Al-Khalili, L., Bouzakri, K., Glund, S., Lönnqvist, F., Koistinen, H. A., & Krook, A.
Affiliations
  • Departments of Molecular Medicine and Surgery (L.A.-K., K.B., S.G., F.L.), S-171 77 Stockholm, Sweden;
  • Helsinki University Hospital (FI)
  • Karolinska Institutet (SE)
Corresponding author
Krook, Anna
ORCID
Venue
Molecular Endocrinology
Publisher
The Endocrine Society
Published
2006-12-01
Volume
20
Issue
12
Pages
3364-3375
ISSN
  • 0888-8809 (ISSN-L)
  • 1944-9917
DOI
10.1210/me.2005-0490
OpenAlex
W2016060556
Semantic Scholar
8de4448729e84ffab008aaf22cdd3c10c1604018
Cited by
250
References
72
Citations by year
2026: 8 · 2025: 8 · 2024: 6 · 2023: 11 · 2022: 11 · 2021: 7 · 2020: 13 · 2019: 10 · 2018: 6 · 2017: 12 · 2016: 11 · 2015: 9 · 2014: 16 · 2013: 21 · 2012: 14
FWCI
7.60
Type
journal article
Language
en
Open access
Locations
  • Molecular Endocrinology (publishedVersion)
  • PubMed (publishedVersion)
  • HAL (submittedVersion)
Funders
  • Foundation for Cardiovascular Research
  • Stiftelsen Forska Utan Djurförsök
  • Petrus och Augusta Hedlunds Stiftelse
  • European Commission (LSHMCT-2004-005272, LSHM-CT-2004-512013)
  • Suomen Kulttuurirahasto
  • Karolinska Institutet
  • Novo Nordisk
  • Vetenskapsrådet
  • Sydäntutkimussäätiö
  • Sveriges Läkarförbund
  • Diabetestutkimussäätiö
  • University at Buffalo
Topics
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Metabolism, Diabetes, and Cancer
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Muscle Physiology and Disorders
  • Health Sciences › Medicine › Physiology › Adipose Tissue and Metabolism
Keywords
interleukin-6, skeletal muscle, glucose metabolism, lipid metabolism, glycogen synthesis, fatty acid oxidation, PI3K signaling, AMPK, peroxisome proliferator-activated receptors, glucose transporter 4, myotube differentiation, insulin signaling
MeSH terms
Phosphoinositide-3 Kinase Inhibitors, Cells, Cultured, Chromones, Fatty Acids, Glucose, Glycogen, Humans, Morpholines, Multienzyme Complexes, Oxidation-Reduction, Phosphorylation, Signal Transduction, Interleukin-6, Protein Serine-Threonine Kinases, Muscle, Skeletal, Muscle Fibers, Skeletal, Lactic Acid, Phosphatidylinositol 3-Kinases, RNA, Small Interfering, Peroxisome Proliferator-Activated Receptors, Lipid Metabolism, Glucose Transporter Type 1, Glucose Transporter Type 4, AMP-Activated Protein Kinases

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-10.

Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-10.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review