CoChat
Sign Up
Cited by 124Muscle metabolism and nutritionMuscle Physiology and DisordersHormonal and reproductive studies

Testosterone and Progesterone, But Not Estradiol, Stimulate Muscle Protein Synthesis in Postmenopausal Women

Open access
Smith, Gordon I., Yoshino, Jun, Reeds, Dominic N., Bradley, David, Burrows, Rachel E., Heisey, Henry D., Moseley, Anna C., Mittendorfer, Bettina·2014·The Journal of Clinical Endocrinology & Metabolism
DOI 10.1210/jc.2013-2835PMC PMC3879672
Open this paper in CoChat — free accountOpen PDF

Abstract

CONTEXT: The effect of the female sex steroids, estradiol and progesterone, on muscle protein turnover is unclear. Therefore, it is unknown whether the changes in the hormonal milieu throughout the life span in women contribute to the changes in muscle protein turnover and muscle mass (eg, age associated muscle loss). OBJECTIVE: The objective of this study was to provide a comprehensive evaluation of the effect of sex hormones on muscle protein synthesis and gene expression of growth-regulatory factors [ie, myogenic differentiation 1 (MYOD1), myostatin (MSTN), follistatin (FST), and forkhead box O3 (FOXO3)]. SUBJECTS AND DESIGN: We measured the basal rate of muscle protein synthesis and the expression of muscle growth-regulatory genes in 12 premenopausal women and four groups of postmenopausal women (n=24 total) who were studied before and after treatment with T, estradiol, or progesterone or no intervention (control group). All women were healthy, and pre- and postmenopausal women were carefully matched on body mass, body composition, and insulin sensitivity. RESULTS: The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (all P<.05) in postmenopausal than premenopausal women. In postmenopausal women, both T and progesterone treatment increased the muscle protein fractional synthesis rate by approximately 50% (both P<.01), whereas it was not affected by estradiol treatment and was unchanged in the control group. Progesterone treatment increased MYOD1 mRNA expression (P<.05) but had no effect on MSTN, FST, and FOXO3 mRNA expression. T and estradiol treatment had no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression. CONCLUSION: Muscle protein turnover is faster in older, postmenopausal women compared with younger, premenopausal women, but these age-related differences do not appear to be explained by the age- and menopause-related changes in the plasma sex hormone milieu.

AI snapshot

Written from the paper’s full text.

TL;DR

In healthy postmenopausal women, testosterone and progesterone treatment increased basal muscle protein synthesis, whereas estradiol did not. Postmenopausal women also had faster basal muscle protein synthesis and higher expression of several muscle growth-regulatory genes than matched premenopausal women.

Key findings

  • Muscle protein fractional synthesis rate (FSR) was approximately 20% faster in postmenopausal than premenopausal women (P = .02), and MYOD1, FST, and FOXO3 mRNA expression was approximately 40%–90% greater (all P < .05).
  • In postmenopausal women, testosterone and progesterone treatment each increased muscle protein FSR by approximately 50% (both P < .01), while estradiol treatment had no effect and the control group was unchanged.
  • Progesterone treatment increased MYOD1 mRNA expression (P < .05) but had no effect on MSTN, FST, or FOXO3; testosterone and estradiol had no effect on MYOD1, MSTN, FST, or FOXO3 mRNA expression.
  • The authors conclude that age- and menopause-related differences in basal muscle protein turnover in women do not appear to be explained by changes in the plasma sex hormone milieu.

Methods

  • Longitudinal, randomized, controlled study in 12 premenopausal and 24 postmenopausal sedentary, weight-stable women; postmenopausal women were randomized to control, testosterone, estradiol, or progesterone (n = 6 per group).
  • Basal mixed muscle protein FSR was measured with a 5-hour [5,5,5-²H₃]leucine infusion and quadriceps muscle biopsies at 120 and 300 minutes; muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression was measured by real-time PCR.
  • Pre- vs postmenopausal comparisons used t tests or Mann-Whitney U tests; treatment effects used repeated-measures ANOVA with Tukey post hoc tests, and gene expression used Kruskal-Wallis with Bonferroni-corrected Mann-Whitney post hoc analyses.

Limitations

  • The paper states that muscle protein breakdown rates and changes in muscle mass were not measured, so it cannot determine whether progesterone-induced increases in synthesis produce net muscle protein gain or increased muscle mass.
  • The paper states that it cannot determine whether larger pharmacological estradiol doses, more prolonged treatment, or estradiol plus progesterone combination therapy would produce different outcomes; it also notes that the estradiol effect was so small (0.0003% ± 0.011%/h) that more than 50,000 subjects would be needed to detect it.
  • Evident from the text: each postmenopausal treatment group had only 6 women, treatment durations were relatively short (21 days for testosterone; intermittent active treatment over about 71 days for estradiol and progesterone), and participants were healthy, sedentary, weight-stable women, which may limit generalizability.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1210/jc.2013-2835

Cites

65 of 65 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

0 of 68 cited sources checked · 0 supported · 0 flagged

  • Findingown data

    Plasma substrate and hormone concentrations are unchanged in the control group of postmenopausal women.

    “Plasma substrate and hormone concentrations were unchanged in the control group (Table 2).”
    Quote in the paperNot a substantial claim
  • Findingown data

    The muscle protein fractional synthesis rate is approximately 20% greater in postmenopausal than premenopausal women.

    “The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (all P Ͻ .05) in postmenopausal than premenopausal women.”
    • Also stated in: § Pre-vs postmenopausal women · plain
      “The muscle protein FSR was approximately 20% greater (P ϭ .02; Figure 1) and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (P Ͻ .05; Figure 2) in postmenopausal than premenopausal women.”
    Quote in the paperSubstantial claim
  • Findingown data

    Testosterone and estradiol treatment have no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression in postmenopausal women.

    “T and estradiol treatment had no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression.”
    • Also stated in: § Effect of hormone treatments in postmenopausal women · plain
      “T and estradiol treatment had no effect on skeletal muscle MYOD1, MSTN, FST, and FOXO3 mRNA expression; progesterone treatment significantly increased MYOD1 mRNA expression”
    Quote in the paperNot a substantial claim
  • Findingown data

    Progesterone treatment increases MYOD1 mRNA expression in postmenopausal women.

    “Progesterone treatment increased MYOD1 mRNA expression (P Ͻ .05)but had no effect on MSTN, FST, and FOXO3 mRNA expression.”
    • Also stated in: § Effect of hormone treatments in postmenopausal women · plain
      “progesterone treatment significantly increased MYOD1 mRNA expression (P Ͻ .05)but had no effect on MSTN, FST, and FOXO3 mRNA expression (Figure 4).”
    Quote in the paperNot a substantial claim
  • Findingown data

    MYOD1, FST, and FOXO3 mRNA expressions are approximately 40%-90% greater in postmenopausal than premenopausal women.

    “The muscle protein fractional synthesis rate was approximately 20% faster, and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (all P Ͻ .05) in postmenopausal than premenopausal women.”
    • Also stated in: § Pre-vs postmenopausal women · plain
      “The muscle protein FSR was approximately 20% greater (P ϭ .02; Figure 1) and MYOD1, FST, and FOXO3 mRNA expressions were approximately 40%-90% greater (P Ͻ .05; Figure 2) in postmenopausal than premenopausal women.”
    Quote in the paperNot a substantial claim
  • Classified as probably not a substantial claim. 20
  • May combine two claims. 22
  • The quote only partly states this claim. 2

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Findingown data

    Postmenopausal women were older and had a somewhat worse plasma lipid profile than premenopausal women.

    “However, postmenopausal women were older (as expected) and had a somewhat worse plasma lipid profile than premenopausal women (Table 1).”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Findingown data

    In the estradiol group, plasma estrogen concentration is significantly elevated 12 hours after patch removal.

    “In the estradiol group, plasma estrogen concentration was significantly elevated 12 hours after the patch removal”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Total and bioavailable plasma testosterone, leucine, and IGF-BP3 concentrations were not different in pre- and postmenopausal women.

    “Total and bioavailable plasma T, leucine, and IGF-BP3 concentrations were not different in pre-and postmenopausal women”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Findingown data

    In the estradiol group, plasma triacylglycerol concentration is reduced by approximately 20% compared with pretreatment values.

    “plasma triacylglycerol concentration was reduced by approximately 20% compared with pretreatment values (both P Ͻ .05;Table 2).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    In the testosterone and progesterone groups, plasma testosterone and progesterone concentrations, respectively, are significantly greater the day after the final treatment dose than before treatment.

    “In the T and progesterone groups, plasma T and progesterone concentrations, respectively, were significantly greater the day after the final treatment dose than before treatment”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    Plasma FSH and cortisol concentrations were significantly greater in postmenopausal than premenopausal women.

    “whereas plasma progesterone, estrogen, IGF-I, and SHBG concentrations were significantly lower and FSH and cortisol concentrations were greater in post-compared with premenopausal women (all P Ͻ .01;Table 1).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    Plasma progesterone, estrogen, IGF-I, and SHBG concentrations were significantly lower in postmenopausal than premenopausal women.

    “whereas plasma progesterone, estrogen, IGF-I, and SHBG concentrations were significantly lower and FSH and cortisol concentrations were greater in post-compared with premenopausal women (all P Ͻ .01;Table 1).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    None of the hormone treatments affected concentrations of insulin, IGF-I, IGF-BP3, or cortisol or resulted in nonspecific sex hormone concentration changes.

    “none of our hormone treatments affected the concentrations of insulin, IGF-I, IGF-BP3, or cortisol or resulted in nonspecific sex hormone concentration changes.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Study design and conductown data

    Pre- and postmenopausal women were well matched on total body mass, body mass index, body composition, and insulin sensitivity.

    “Pre-and postmenopausal women were well matched on total body mass, body mass index, body composition, and insulin sensitivity (Table 1).”
    • Also stated in: § Abstract · plain
      “pre-and postmenopausal women were carefully matched on body mass, body composition, and insulin sensitivity.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Interpretationown data

    Progesterone has potent stimulatory effects on muscle protein synthesis and MYOD1 mRNA expression.

    “whereas progesterone has potent stimulatory effects on muscle protein synthesis and MYOD1 mRNA expression.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Premisecitation

    Testosterone increases muscle protein synthesis and muscle mass.

    “T is a well-known anabolic steroid; it increases muscle protein synthesis (3-7) and muscle mass (8 -11)”
    Quote in the paperSubstantial claim0 of 9 sources checked
    • cites [3]

      Not checked in the free run.

    • cites [4]

      Not checked in the free run.

    • cites [5]

      Not checked in the free run.

    • cites [6]

      Not checked in the free run.

    • cites [7]

      Not checked in the free run.

    • cites [8]

      Not checked in the free run.

    • cites [9]

      Not checked in the free run.

    • cites [10]

      Not checked in the free run.

    • cites [11]

      Not checked in the free run.

  • May combine two claims.

    Interpretationown data

    Estradiol has no effect on muscle protein synthesis or the expression of genes involved in the regulation of muscle mass.

    “We have demonstrated that estradiol has no effect on muscle protein synthesis or the expression of genes involved in the regulation of muscle mass”
    Quote in the paperSubstantial claim

  • Classified as probably not a substantial claim. May combine two claims.

    Premisecitation

    A study on rodents showed that ovariectomy increases and progesterone and estradiol suppress the rate of muscle protein synthesis.

    “a study on rodents showed that ovariectomy increases and progesterone and estradiol suppress the rate of muscle protein synthesis (13).”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [13]

      Not checked in the free run.

  • May combine two claims.

    Premisecitation

    Oral administration of synthetic female sex hormone derivatives alters the concentration of anabolic and catabolic hormones (eg, IGF-I, cortisol) in plasma, whereas systemic delivery of unmodified hormones does not.

    “oral administration of synthetic female sex hormone derivatives alters the concentration of anabolic and catabolic hormones (eg, IGF-I, cortisol) in plasma, whereas systemic delivery of unmodified hormones does not (20 -22).”
    Quote in the paperSubstantial claim0 of 3 sources checked
    • cites [20]

      Not checked in the free run.

    • cites [21]

      Not checked in the free run.

    • cites [22]

      Not checked in the free run.

  • May combine two claims.

    Interpretationown data

    The age-related upregulation of catabolic genes supports the concept of increased muscle protein breakdown and helps explain age-associated loss of muscle mass despite increased muscle protein synthesis.

    “that supports this concept and helps explain the ageassociated loss of muscle mass in the face of an increased muscle protein synthesis rate.”
    Quote in the paperNot a substantial claim
    • Rests on an assumption: Changes in mRNA expression of catabolic genes (FOXO3 and MuRF1) reflect changes in muscle protein breakdown rate.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    A study conducted in growing steer found that estradiol increases the rate of muscle protein synthesis.

    “whereas a study conducted in growing steer found that estradiol increases the rate of muscle protein synthesis (50).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [50]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Interpretationreasoning

    The concomitant up-regulation of both muscle protein synthesis and breakdown in old compared with young women might be indicative of increased skeletal muscle remodeling in post- compared with premenopausal women.

    “Furthermore, the concomitant up-regulation of both muscle protein synthesis and breakdown in old compared with young women might further be indicative of increased skeletal muscle remodeling in post-compared with premenopausal women.”
    Quote in the paperNot a substantial claim
    • Rests on an assumption: Muscle mass is determined by the balance between muscle protein synthesis and breakdown, so a higher synthesis rate with declining muscle mass implies increased breakdown.

  • Classified as probably not a substantial claim. May combine two claims.

    Study design and conductnone given

    None of the subjects had evidence of chronic illness or significant organ dysfunction or were taking medications that could interfere with muscle protein metabolism.

    “None of the subjects had evidence of chronic illness or significant organ dysfunction (eg, diabetes mellitus, cirrhosis) or were taking medications (including hormone replacement therapy or hormonal contraceptives) that could interfere with muscle protein metabolism”
    Quote in the paperSubstantial claim

  • Classified as probably not a substantial claim.

    Study design and conductcitation

    The free leucine labeling in muscle tissue fluid represents the immediate precursor for muscle protein synthesis.

    “The free leucine labeling in muscle tissue fluid was chosen to represent the immediate precursor for muscle protein synthesis (ie, aminoacyl-t-RNA) (41).”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [41]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Interpretationcitation

    The lack of effect of estradiol on muscle growth-regulatory gene expression in our study is consistent with the results from studies conducted in rodents.

    “The lack of effect of estradiol on muscle growth-regulatory gene expression in our study is consistent with the results from studies conducted in rodents.”
    Quote in the paperNot a substantial claim0 of 3 sources checked
    • cites [45]

      Not checked in the free run.

    • cites [46]

      Not checked in the free run.

    • cites [47]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing). The quote only partly states this claim.

    Study design and conductown data

    The expression of genes of interest normalized against GAPDH gave the same results as normalization against ACTB.

    “we also compared the expression of our genes of interest against ␤-actin (ACTB, forward, CATGTACGTTGCTATCCAGGC, reverse, CTCCT-TAATGTCACGCACGAT) and the results were the same (data not shown).”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Premisecitation

    Estradiol treatment augments muscle MYOD1 expression during recovery from muscle injury in ovariectomized rats and prevents the orchidetcomy-induced decrease in FBXO32 expression.

    “However, estradiol treatment augments muscle MYOD1 expression during recovery from muscle injury in ovariectomized rats (45,46,49) and prevents the orchidetcomy-induced decrease in FBXO32 expression (47).”
    Quote in the paperNot a substantial claim0 of 4 sources checked
    • cites [45]

      Not checked in the free run.

    • cites [46]

      Not checked in the free run.

    • cites [49]

      Not checked in the free run.

    • cites [47]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    The basal rate of muscle protein synthesis is less in women who use oral hormonal contraceptives compared with those who do not.

    “and less in women who use oral, hormonal contraceptives compared with those who do not (16).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [16]

      Not checked in the free run.

  • May combine two claims. The quote only partly states this claim.

    Study design and conductreasoning

    The hormone treatments were selected to mimic normal physiological conditions, with estradiol and progesterone provided in replacement doses and delivered systemically.

    “we chose to provide 17␤-es-tradiol and micronized progesterone in replacement doses and delivered them to tissues through the systemic circulation to avoid these confounding influences”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Interpretationcitation

    Our study confirms previous observations by our own and other research groups concerning the anabolic effect of testosterone and an age-related up-regulation of both stimulatory and inhibitory muscle growth regulatory genes and accelerated basal muscle protein turnover in women.

    “Our study confirms previous observations by our own and other research groups concerning the anabolic effect of T (3-7) and an age-related up-regulation of both stimulatory and inhibitory muscle growth regulatory genes and accelerated basal muscle protein turnover in women (14,43,44), which might be indicative of increased skeletal muscle remodeling in post-compared with premenopausal women.”
    Quote in the paperSubstantial claim0 of 8 sources checked
    • cites [3]

      Not checked in the free run.

    • cites [4]

      Not checked in the free run.

    • cites [5]

      Not checked in the free run.

    • cites [6]

      Not checked in the free run.

    • cites [7]

      Not checked in the free run.

    • cites [14]

      Not checked in the free run.

    • cites [43]

      Not checked in the free run.

    • cites [44]

      Not checked in the free run.

  • May combine two claims.

    Interpretationcitation

    The mechanism responsible for the anabolic effect of progesterone is different from that of testosterone and most likely results from progesterone receptor rather than androgen receptor activation.

    “our data suggest that the mechanism(s) responsible for the anabolic effect of progesterone is different from that of T and therefore most likely the result of progesterone receptor rather than androgen receptor activation”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites [53]

      Not checked in the free run.

  • Classified as probably not a substantial claim.

    Study design and conductown data

    Postmenopausal women were randomized to one of four groups: control, testosterone, estradiol, or progesterone treatment.

    “postmenopausal women were randomized to one of four groups (n ϭ 6 per group): control (no intervention), and T, estradiol, or progesterone treatment”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Study design and conductnone given

    Written informed consent was obtained from all subjects and the study was approved by the Institutional Review Board of Washington University School of Medicine.

    “Written informed consent was obtained from all subjects before participation in the study, which was approved by the Institutional Review Board of Washington University School of Medicine (St Louis, Missouri).”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    All women were healthy.

    “All women were healthy”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Study design and conductown data

    Muscle protein breakdown rates and changes in muscle mass in response to the different sex hormone treatments were not measured in this study.

    “We did not measure muscle protein breakdown rates or changes in muscle mass in response to the different sex hormone treatments in this study.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Increased adiposity may affect the rate of muscle protein turnover.

    “Evidence is emerging that increased adiposity may affect the rate of muscle protein turnover (19)”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [19]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S1 (asserted), S3 (load-bearing). May combine two claims.

    Premisecitation

    There is no difference in the rate of muscle protein synthesis between hormone users and nonusers, between young and old women, or between women studied during the follicular or luteal phases of their menstrual cycle.

    “Others, however, reported no difference in the rate of muscle protein synthesis between hormone users and nonusers (16), between young and old women (17), or between women who were studied during the follicular or the luteal phases of their menstrual cycle (18).”
    Quote in the paperNot a substantial claim0 of 3 sources checked
    • cites [16]

      Not checked in the free run.

    • cites [17]

      Not checked in the free run.

    • cites [18]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S1 (asserted), S3 (load-bearing).

    Premisecitation

    The basal rate of muscle protein synthesis is less in women who received estrogen replacement therapy after hysterectomy than age-matched postmenopausal women.

    “other investigators reported that the basal rate of muscle protein synthesis is less in women who received estrogen replacement therapy after hysterectomy than age-matched postmenopausal women (15)”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [15]

      Not checked in the free run.

  • Classified as probably not a substantial claim.

    Study design and conductnone given

    Compliance with the interventions was confirmed by regular phone interviews and pill count at the end of the study.

    “Compliance with the interventions was confirmed by regular phone interviews and pill count at the end of the study.”
    Quote in the paperSubstantial claim

  • Classified as probably not a substantial claim.

    Study design and conductown data

    The study was unlikely underpowered to detect a change in muscle protein FSR after estradiol treatment.

    “It is conceivable (although we consider it unlikely) that our study was underpowered to detect a change in muscle protein FSR after estradiol treatment.”
    • Also stated in: § Discussion · plain
      “In fact, the pre-and posttreatment difference in muscle protein FSR in the estradiol group was so small (0.0003% Ϯ 0.011%/h) that we would have needed more than 50 000 subjects to detect it with a sufficiently small probability of type I error (␣ Ͻ .05) and sufficient power (Ն .80) to reject the null hypothesis.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Premisecitation

    Another study reported an increase in lean body mass but lacked a placebo control group.

    “the other reported an increase (56) but lacked a placebo control group to rigorously judge the effect.”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites [56]

      Not checked in the free run.

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    The study was registered in clinicaltrials.gov as trial number NCT00805207.

    “This study was registered in clinicaltrials.govas trial number NCT00805207.”
    Quote in the paperNot a substantial claim
37 of 37

  • The paper relies on this without support.

    Muscle mass is determined by the balance between muscle protein synthesis and breakdown, so a higher synthesis rate with declining muscle mass implies increased breakdown.

    “our data from young, premenopausal vs older, postmenopausal women (greater synthesis rate in old compared with young women) and the well-established decline in muscle mass with aging (59 -61) indicate that older women must (by deduction) also have an increased rate of muscle protein breakdown.”

  • The paper relies on this without support.

    Changes in mRNA expression of catabolic genes (FOXO3 and MuRF1) reflect changes in muscle protein breakdown rate.

    “we (present study) and others (44) have observed an age-related upregulation of catabolic genes (ie, FOXO3 and MuRF1 mRNA expression) in muscle that supports this concept and helps explain the ageassociated loss of muscle mass in the face of an increased muscle protein synthesis rate.”

  • The paper relies on this without support.

    Increased MYOD1 mRNA expression reflects increased satellite cell activation.

    “Increased progesterone-induced MYOD1 expression suggests increased satellite cell activation may play a role in this observation.”
3 of 3

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

  • Testosterone supplementation in postmenopausal women leads to a 50% increase in protein synthesis rate compared with no effect with estrogen treatment.

    “Additionally, testosterone supplementation in postmenopausal women leads to a 50% increase in protein synthesis rate compared with no effect with estrogen treatment (87).”

    From Sex-Based Differences in Skeletal Muscle Kinetics and Fiber-Type Composition (2015) · cites this paper as [87]

Self-check

Percentages, sums and reported differences re-computed from the paper’s own numbers.

Each contradiction between two passages listed here was confirmed by an independent check.

  • IGF-I mass-concentration units differ between tables

    Minor

    Table 1 gives IGF-I concentrations in ng/dL, while Table 2 gives comparable baseline concentrations in ng/mL. Those units differ by a factor of 100, without a corresponding difference in the reported concentrations.

  • Cortisol mass-concentration units differ between tables

    Minor

    Table 1 labels baseline cortisol concentrations in ng/dl, whereas Table 2 labels concentrations for the same study population in ng/mL. The similar numerical values and nM concentrations do not reflect a 100-fold unit change.

  • IGF-BP3 mass-concentration units differ between tables

    Minor

    Table 1 labels IGF-BP3 concentrations in ng/dL, but Table 2 labels comparable baseline concentrations in ng/mL. The numerical values are on the same scale despite the 100-fold difference between those units.

3 of 3

Cites

Flagged first, then by citations

1 of the 66 references couldn’t be matched to a known paper.

Cited by

Sorted by citations

Related

Authors
Smith, G. I., Yoshino, J., Reeds, D. N., Bradley, D., Burrows, R. E., Heisey, H. D., Moseley, A. C., & Mittendorfer, B.
Affiliations
Washington University in St. Louis (US)
Corresponding author
Mittendorfer, Bettina
ORCID
Venue
The Journal of Clinical Endocrinology & Metabolism
Publisher
The Endocrine Society
Published
2014-01
Volume
99
Issue
1
Pages
256-265
ISSN
  • 0021-972X (ISSN-L)
  • 1945-7197
DOI
10.1210/jc.2013-2835
PMC
PMC3879672
OpenAlex
W1984814458
Semantic Scholar
212b5fbdc15425ec0f98adb01fa360fe295f8550
Cited by
124
References
66
Citations by year
2026: 9 · 2025: 16 · 2024: 11 · 2023: 13 · 2022: 10 · 2021: 13 · 2020: 11 · 2019: 11 · 2018: 7 · 2017: 5 · 2016: 10 · 2015: 3 · 2014: 4
FWCI
3.29
Type
journal article
Language
en
Open access
Locations
  • The Journal of Clinical Endocrinology & Metabolism (publishedVersion)
  • Europe PMC (PubMed Central) (publishedVersion)
  • PubMed Central (publishedVersion)
  • PubMed (publishedVersion)
Funders
  • National Institutes of Health (KL2TR000450, 5p41rr000954-34, UL1TR000448)
  • National Heart, Lung, and Blood Institute (T32HL007456)
  • National Institute of Diabetes and Digestive and Kidney Diseases (DK-94483, DK56341, R01DK094483, P30DK056341)
  • National Center for Research Resources (P41-RR000954, RR024994, RR-024992, RR 00954, KL2RR024994, UL1RR024992)
  • National Center for Advancing Translational Sciences
  • Eunice Kennedy Shriver National Institute of Child Health and Human Development (P50HD057796, HD57796)
Topics
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Cell Biology › Muscle metabolism and nutrition
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Muscle Physiology and Disorders
  • Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Hormonal and reproductive studies
Keywords
muscle protein synthesis, postmenopausal women, testosterone, progesterone, estradiol, sex hormones, muscle protein turnover, myostatin, follistatin, FOXO3, age-related muscle loss, skeletal muscle
MeSH terms
Adult, Blood Glucose, Body Composition, Estradiol, Female, Humans, Insulin, Middle Aged, Muscle Proteins, Progesterone, Testosterone, Gene Expression, Premenopause, Postmenopause, Muscle, Skeletal

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-09.

Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-09.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review