Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.
Open accessAbstract
Summary Cells, the basic units of biological structure and function, vary broadly in type and state. Single-cell genomics can characterize cell identity and function, but limitations of ease and scale have prevented its broad application. Here we describe Drop-Seq, a strategy for quickly profiling thousands of individual cells by separating them into nanoliter-sized aqueous droplets, associating a different barcode with each cell’s RNAs, and sequencing them all together. Drop-Seq analyzes mRNA transcripts from thousands of individual cells simultaneously while remembering transcripts’ cell of origin. We analyzed transcriptomes from 44,808 mouse retinal cells and identified 39 transcriptionally distinct cell populations, creating a molecular atlas of gene expression for known retinal cell classes and novel candidate cell subtypes. Drop-Seq will accelerate biological discovery by enabling routine transcriptional profiling at single-cell resolution.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
High-throughput perturbation screens based on RNA-seq, optical pooled screens (OPS), or other technologies offer a rich resource through which the AIVC can be trained to predict perturbation effects.
“Here, high-throughput perturbation screens—based on RNA-seq,28,83,90 optical pooled screens (OPS),29,39,91 or other technologies—offer a rich resource through which the AIVC can be trained to predict these effects.”
From How to build the virtual cell with artificial intelligence: Priorities and opportunities (2024) · cites this paper as [83]
The Results describe Drop-Seq as a high-throughput single-cell RNA-seq method, and the Discussion proposes that coupling it to perturbations could yield information-rich readouts. The paper does not report a perturbation screen; it presents that application as a possibility. The optical-screen citations and the citing authors’ proposed AIVC use are not attributed to this source. (LLM, conf=0.86)
Experimental — accuracy not yet measuredAn alternative way to break droplets in the Drop-seq protocol recovered beads much more efficiently than the original Drop-seq publication.
“Our most important modification to the Drop-seq protocol was an alternative way to break droplets, which recovered beads much more efficiently than in the original publication of Drop-seq 7 .”
From Pooled CRISPR screening with single-cell transcriptome readout. (2017) · cites this paper as [7]
The Experimental Procedures (‘Drop-Seq procedure’; page not provided) describe the original method of breaking droplets with perfluorooctanol and then washing the beads. The paper does not evaluate the citing authors’ alternative method or compare bead-recovery efficiency, so it supports the identification of the original protocol but not the claimed improvement. (LLM, conf=0.84)
Experimental — accuracy not yet measuredThe top 50 principal components explained more than 90% of single-cell variance.
“Because the top 50 PCs explained more than 90% of single-cell variance (Supplementary Figure S4), we chose them to cluster 175 MEFs by Seurat package (Macosko et al., 2015).”
From Single-Cell Transcriptome Analysis Reveals Six Subpopulations Reflecting Distinct Cellular Fates in Senescent Mouse Embryonic Fibroblasts (2020) · cites this paper as Macosko et al., 2015
Simultaneously demultiplexing and detecting doublets from more than two individuals has not been possible.
“While strategies to demultiplex cells from different species1, 10, 17 or host and graft samples17 have been reported, simultaneously demultiplexing and detecting doublets from more than two individuals has not been possible.”
From Multiplexed droplet single-cell RNA-sequencing using natural genetic variation (2018) · cites this paper as [1]
Droplet single-cell RNA sequencing has made it possible to profile transcriptomes rapidly and at large scale.
“Droplet single cell RNA-sequencing (dscRNA-seq) has increased substantially the throughput of single cell capture and library preparation1, 10, enabling the simultaneous profiling of thousands of cells.”
From Multiplexed droplet single-cell RNA-sequencing using natural genetic variation (2018) · cites this paper as [1]
Single-cell RNA sequencing has emerged as a powerful method for unbiased discovery of cell types and states based on gene activity.
“single-cell RNA sequencing (scRNA-seq) has emerged as a powerful method for unbiased discovery of cell types and states based on gene activity (Islam et al., 2011, Jaitin et al., 2014, Macosko et al., 2015, Ramsköld et al., 2012, Shekhar et al., 2016, Tang et al., 2009, Tasic et al., 2016, Usoskin et al., 2015, Zeisel et al., 2015)”
From Molecular Architecture of the Mouse Nervous System (2018) · cites this paper as Macosko et al., 2015
CROP-seq combines four key components: a gRNA vector detectable in single-cell RNA-seq, a high-throughput single-cell RNA-seq assay, a computational pipeline for assigning single-cell transcriptomes to gRNAs, and a bioinformatic method for analyzing gRNA-induced transcriptional profiles.
“Implementing this concept, our CROP-seq method combines four key components: a gRNA vector that makes individual gRNAs detectable in single-cell RNA-seq experiments, a high-throughput assay for single-cell RNA-seq 7 , a computational pipeline for assigning single-cell transcriptomes to gRNAs, and a bioinformatic method for analyzing and interpreting gRNA-induced transcriptional profiles.”
From Pooled CRISPR screening with single-cell transcriptome readout. (2017) · cites this paper as [7]
Drop-seq on a 1:1:1 mixture of three knockout cell lines provided high sequencing coverage for gRNAs and allowed assignment of single cells to gRNAs at expected ratios.
“When we applied Dropseq 7 on a 1:1:1 mixture of the three cell lines, the resulting single-cell transcriptomes provided high sequencing coverage for the gRNAs, and we were able to assign single cells to gRNAs at the expected ratios (Fig. 1h).”
From Pooled CRISPR screening with single-cell transcriptome readout. (2017) · cites this paper as [7]
Synaptosome genes and ambient RNA are enriched within nucleus-abundant genes.
“This is supported by the enrichment of synaptosome genes (NES = 1.82, padj = 3.6e-05, Figure 2A; Hafner et al., 2019) and ambient RNA—mRNA originating not from intact cells/nuclei but from free-floating transcripts (Macosko et al., 2015)—(NES = 1.71, padj = 9.2e-05; Figure 2A; Figure S2D) within the nucleus-abundant genes.”
From Single-Nucleus RNA-Seq Is Not Suitable for Detection of Microglial Activation Genes in Humans (2020) · cites this paper as Macosko et al., 2015
Mixing species is an effective strategy to demultiplex samples.
“Although limited to two samples, as shown in our analysis, sex chromosomes are also an effective strategy to demultiplex 2 samples [43], as can the mixing of species—as in a barnyard experiment [11].”
From Benchmarking of computational demultiplexing methods for single-nucleus RNA sequencing data (2025) · cites this paper as [11]
The species-mixing datasets allow direct identification of contaminating mRNAs and testing of SoupX's accuracy.
“We first investigate 2 “species mixing” datasets run on the Chromium 10X [2] and DropSeq [14] platforms, which allow us to directly identify contaminating mRNAs and test our method’s accuracy.”
From SoupX removes ambient RNA contamination from droplet-based single-cell RNA sequencing data (2020) · cites this paper as [14]
A similar cross-species contamination effect is seen in Drop-Seq-based species-mixing data.
“A similar effect is seen in the Drop-Seq–based species-mixing data (Supplementary Fig. S3).”
From SoupX removes ambient RNA contamination from droplet-based single-cell RNA sequencing data (2020) · cites this paper as [14]
TAP-seq was implemented for 10X Genomics and Drop-seq.
“is implemented here for 10X Genomics15 and Drop-seq16.”
From Targeted Perturb-seq enables genome-scale genetic screens in single cells (2020) · cites this paper as [16]
The C1 system allows direct confirmation of single cell capture events.
“Notably, in the context of this study, the C1 system also allows for direct confirmation of single cell capture events, in contrast to most other microfluidic-based approaches322.”
From Batch effects and the effective design of single-cell gene expression studies (2017) · cites this paper as [3]
The C1 platform has advantages over droplet-based platforms: smaller samples can be processed and capture efficiency of genes and RNA molecules is markedly higher.
“The automated C1 microfluidic platform (Fluidigm), while more expensive per sample, has been shown to confer several advantages over platforms that make use of droplets to capture single cells321. In particular, smaller samples can be processed using the C1 (when cell numbers are limiting), and the C1 capture efficiency of genes (and RNA molecules) is markedly higher.”
From Batch effects and the effective design of single-cell gene expression studies (2017) · cites this paper as [3]
DROP-seq can profile more than 10,000 cells at a time.
“Other methods, such as DROP-seq [175], can profile more than 10,000 cells at a time.”
From A survey of best practices for RNA-seq data analysis (2016) · cites this paper as [175]
The scale and precision of single-cell studies has continued to increase, reaching tens of thousands of cells for massively parallel scRNA-seq and millions of cells for mass cytometry protein measurements.
“The scale and precision of such studies has continued to increase, reaching tens of thousands of cells for massively parallel scRNA-seq30,31 and millions of cells for mass cytometry signature protein measurements32–34.”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Doublets in scRNA-seq can manifest as high-quality cells by many measures and lead to erroneous biological conclusions, such as false detection of 'hybrids' that are actually mixtures of RNA from two or more cells.
“These can manifest as high-quality cells by many measures (more transcripts, more complex libraries) and lead to erroneous biological conclusions, such as false detection of ‘hybrids’—cells that seem to be an intermediate type between two distinct cell populations but are in fact a mixture of RNA from two or more cells (A.R. and colleagues30).”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Spike-in controls do not control for technical variation that occurs before their introduction, especially tissue acquisition, dissociation, sorting, and lysis.
“However, although spike-in controls provide important information59, they do not control for any technical variation preceding their introduction, especially tissue acquisition, dissociation, sorting and lysis30.”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Factors defining cell identity may be discrete categories, continuous spectra, or combinations of discrete and continuous categories.
“These factors may not only be the discrete categories that are often assumed when classifying cells into major types4,30,94 but may also represent a continuous spectrum1, or a combination of discrete and continuous categories36,95–97,227.”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Through deconvolution of complex samples, one may infer their cellular milieu and characterize rare, functionally important, and unknown cell types they contain.
“Through deconvolution of complex samples30, such as tumor biopsies35, one may infer their cellular milieu, and characterize the rare5, functionally important1, and unknown36 cell types they contain.”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Several studies inferred individual cells' cell cycle phase from scRNA-seq using transcriptional signatures of discrete phases from earlier bulk profiling.
“Several studies inferred the cell cycle phase of individual cells from single-cell RNA-seq data30,35,97,99, relying on transcriptional signatures of discrete phases from earlier bulk profiling experiments146.”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Single-cell profiles provide near-continuous sampling and show high conservation across cell types and species.
“single-cell profiles provide a near-continuous sampling and show high conservation across cell types and species30,97,99”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Using the latest protocols for massively parallel scRNA-seq and mass cytometry, a single laboratory can now readily collect tens of thousands to hundreds of thousands of single-cell RNA-seq profiles and tens of millions of single-cell protein profiles.
“Using the latest protocols for massively parallel scRNA-seq30,31 and mass cytometry32–34, a single laboratory can now readily collect tens of thousands to hundreds of thousands of single-cell RNA-seq profiles and tens of millions of single-cell protein profiles.”
From Revealing the vectors of cellular identity with single-cell genomics (2016) · cites this paper as [30]
Fibroblast proliferation, a key step in fibrogenesis, depends on trophism exerted by PDGF-AA+ macrophages recruited to sites of injury.
“Together, these results suggest the dependence of fibroblast proliferation, which is a key step in fibrogenesis38, on trophism exerted by PDGF-AA+ macrophages recruited to sites of injury.”
From Reference-based analysis of lung single-cell sequencing reveals a transitional profibrotic macrophage (2019) · cites this paper as [38]
Single-cell transcriptomics enables unbiased, high-throughput quantitative surveys of molecularly defined cell types across species including human.
“Single cell transcriptomics enables unbiased, high-throughput quantitative surveys of molecularly defined cell types4–6 that can be applied to any species including human.”
From Transcriptomic and morphophysiological evidence for a specialized human cortical GABAergic cell type (2018) · cites this paper as [6]
Massively parallel scRNA-seq methods such as Drop-seq can be applied at scale cost-effectively but require intact single-cell suspensions.
“massively parallel scRNA-seq methods, such as Drop-seq7 and related methods8–10 can be readily applied at scale11 in a cost-effective manner12, but require intact single cell suspension as input.”
From Massively parallel single-nucleus RNA-seq with DroNc-seq (2017) · cites this paper as [7]
Transcriptomically derived taxonomies in adult mammalian brain consistently show a hierarchical organization of cell types.
“Transcriptomically derived cell type taxonomies in the adult mammalian brain, with majority of the studies conducted in mouse, have consistently revealed a hierarchical organization of cell types (Fig. 2) (Brain Initiative Cell Census Network, 2021; Macosko et al., 2015; Romanov et al., 2017; Russ et al., 2021; Saunders et al., 2018; Shekhar et al., 2016; Tasic et al., 2016; Tasic et al., 2018;”
From What is a cell type and how to define it? (2022) · cites this paper as Macosko et al., 2015
Large-scale scRNAseq technology has been able to provide comprehensive molecular analysis of neuronal diversity only in the past 4 years.
“However, it is only in the past 4 years that large-scale scRNAseq technology has been able to provide a comprehensive molecular analysis of neuronal diversity20,21.”
From The diversity of GABAergic neurons and neural communication elements (2019) · cites this paper as [20]
Drop-seq sequencing of 220 neurons recaptured subsets of GABA, glutamate and dopamine cells that contained genes for alternative neurotransmission.
“In 220 neurons, we recaptured subsets of GABA, glutamate and dopamine cells that contained genes for alternative neurotransmission”
From Molecular interrogation of hypothalamic organization reveals distinct dopamine neuronal subtypes (2017) · cites this paper as [22]
Drop-seq data processing was performed on 220 neurons.
“Drop-seq data processing of 220 neurons as output was performed using the Drop-seq Tools v1.12 software22.”
From Molecular interrogation of hypothalamic organization reveals distinct dopamine neuronal subtypes (2017) · cites this paper as [22]
Droplet and well-based single-cell RNA-sequencing technologies can isolate and barcode cell transcriptomes at high throughput and relatively low cost.
“Droplet microfluidic (Klein et al., 2015; Macosko et al., 2015; Zheng et al., 2017) and well-based (Cao et al., 2017; Gierahn et al., 2017; Han et al., 2018; Rosenberg et al., 2018) technologies now enable the relatively inexpensive, high-throughput isolation and barcoding of cell transcriptomes.”
From Scrublet: computational identification of cell doublets in single-cell transcriptomic data (2019) · cites this paper as Macosko et al., 2015
Differences between human and mouse genomic sequence provide an independent way to detect human-mouse doublets.
“This dataset, though not representative of most single-cell experiments, provides a useful test case because the differences between human and mouse genomic sequence provide an independent way to detect doublets (Klein et al., 2015; Macosko et al., 2015).”
From Scrublet: computational identification of cell doublets in single-cell transcriptomic data (2019) · cites this paper as Macosko et al., 2015
In typical single-cell RNA-sequencing experiments, at least a few percent of capture events are multiplets.
“In a typical scRNA-seq experiment, at least several percent of all capture events are multiplets (Cao et al., 2017; Klein et al., 2015; Macosko et al., 2015; Zheng et al., 2017).”
From Scrublet: computational identification of cell doublets in single-cell transcriptomic data (2019) · cites this paper as Macosko et al., 2015
The single-cell transcriptomics field is divided into two major categories: microfluidics droplet-based and microwell plate-based.
“The field has rapidly developed ever since and is divided into two major categories: microfluidics droplet-based transcriptomics7–10 and microwell plate-based11–13 transcriptomics (Box 1).”
From The technological landscape and applications of single-cell multi-omics (2023) · cites this paper as [9]
Conserved cell cycle genes from a well-established HeLa dataset were used as seeds to reconstruct five cell cycle phases along microglial division pseudotime.
“We used lists of conserved genes from a well-established dataset for HeLa cell lines as the “seeds” to reconstruct 5 cell cycle phases along microglial division pseudotime (Macosko et al., 2015; Whitfield et al., 2002).”
From Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing (2019) · cites this paper as Macosko et al., 2015
PCA summarizes a dataset via its top N principal components, where N can be determined by elbow heuristics or the jackstraw method.
“Typically, PCA summarizes a dataset via its top N principal components, where N can be determined by “elbow” heuristics (see Fig 4F) or the permutation‐test‐based jackstraw method (Chung & Storey, 2015; Macosko et al, 2015).”
From Current best practices in single-cell RNA-seq analysis: a tutorial (2019) · cites this paper as Macosko et al, 2015
Down-regulation of ribosomal genes and bulk protein synthesis has long been considered a hallmark of aging.
“Notably, the down-regulation of ribosomal genes and bulk protein synthesis has been long considered as a hallmark of aging 54,55 .”
From Single-cell transcriptomic profiling of the aging mouse brain (2019) · cites this paper as [55]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
(2008) · Journal of Machine Learning Research · Cited by 33,051 · see citing works
(1996) · Cited by 20,179 · see citing works
Spatial reconstruction of single-cell gene expression data
Satija, R., Farrell, J. A., Gennert, D., Schier, A. F., & Regev, A. (2015) · Nature Biotechnology · doi:10.1038/nbt.3192 · Cited by 7,055 · see citing works
Self-citationmRNA-Seq whole-transcriptome analysis of a single cell
Tang, F., Barbacioru, C., Wang, Y., Nordman, E., Lee, C., Xu, N., Wang, X., Bodeau, J., Tuch, B. B., Siddiqui, A., et al. (2009) · Nature Methods · doi:10.1038/nmeth.1315 · Cited by 3,969 · see citing works
Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells
Klein, A. M., Mazutis, L., Akartuna, I., Tallapragada, N., Veres, A., Li, V., Peshkin, L., Weitz, D. A., & Kirschner, M. W. (2015) · Cell · doi:10.1016/j.cell.2015.04.044 · Cited by 3,356 · see citing works
Self-citationHigh-throughput droplet digital PCR system for absolute quantitation of DNA copy number
Hindson, B. J., Ness, K. D., Masquelier, D. A., Belgrader, P., Heredia, N. J., Makarewicz, A. J., Bright, I. J., Lucero, M. Y., Hiddessen, A. L., Legler, T. C., et al. (2011) · Analytical Chemistry · doi:10.1021/ac202028g · Cited by 2,792 · see citing works
Britten, R. J., & Kohne, D. E. (1968) · Science · doi:10.1126/science.161.3841.529 · Cited by 2,789 · see citing works
Smart-seq2 for sensitive full-length transcriptome profiling in single cells
Picelli, S., Björklund, Å. K., Faridani, O. R., Sagasser, S., Winberg, G., & Sandberg, R. (2013) · Nature Methods · doi:10.1038/nmeth.2639 · Cited by 2,358 · see citing works
Dynamic Pattern Formation in a Vesicle-Generating Microfluidic Device
Thorsen, T., Roberts, R. W., Arnold, F. H., & Quake, S. R. (2001) · Physical Review Letters · doi:10.1103/physrevlett.86.4163 · Cited by 2,052 · see citing works
Massively parallel single-cell RNA-seq for marker-free decomposition of tissues into cell types
Jaitin, D. A., Kenigsberg, E., Keren-Shaul, H., Elefant, N., Paul, F., Zaretsky, I., Mildner, A., Cohen, N., Jung, S., Tanay, A., et al. (2014) · Science · doi:10.1126/science.1247651 · Cited by 1,795 · see citing works
Vogelstein, B., & Kinzler, K. W. (1999) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.96.16.9236 · Cited by 1,770 · see citing works
Amir, E.-A. D., Davis, K. L., Tadmor, M. D., Simonds, E. F., Levine, J. H., Bendall, S. C., Shenfeld, D. K., Krishnaswamy, S., Nolan, G. P., & Pe'er, D. (2013) · Nature Biotechnology · doi:10.1038/nbt.2594 · Cited by 1,550 · see citing works
Whitfield, M. L., Sherlock, G., Saldanha, A. J., Murray, J. I., Ball, C. A., Alexander, K. E., Matese, J. C., Perou, C. M., Hurt, M. M., Brown, P. O., et al. (2002) · Molecular Biology of the Cell · doi:10.1091/mbc.02-02-0030 · Cited by 1,527 · see citing works
Petilla terminology: nomenclature of features of GABAergic interneurons of the cerebral cortex
The Petilla Interneuron Nomenclature Group (PING) (2008) · Nature Reviews Neuroscience · doi:10.1038/nrn2402 · Cited by 1,491 · see citing works
The Major Cell Populations of the Mouse Retina
Jeon, C.-J., Strettoi, E., & Masland, R. H. (1998) · The Journal of Neuroscience · doi:10.1523/jneurosci.18-21-08936.1998 · Cited by 1,429 · see citing works
Kinetics of renaturation of DNA
Wetmur, J. G., & Davidson, N. (1968) · Journal of Molecular Biology · doi:10.1016/0022-2836(68)90414-2 · Cited by 1,426 · see citing works
Single-cell analysis and sorting using droplet-based microfluidics
Mazutis, L., Gilbert, J., Ung, W. L., Weitz, D., Griffiths, A., & Heyman, J. A. (2013) · Nature Protocols · doi:10.1038/nprot.2013.046 · Cited by 1,267 · see citing works
Self-citationCEL-seq: single-cell RNA-seq by multiplexed linear amplification
Hashimshony, T., Wagner, F., Sher, N., & Yanai, I. (2012) · Cell Reports · doi:10.1016/j.celrep.2012.08.003 · Cited by 1,231 · see citing works
Single-cell transcriptomics reveals bimodality in expression and splicing in immune cells
Shalek, A. K., Satija, R., Adiconis, X., Gertner, R. S., Gaublomme, J. T., Raychowdhury, R., Schwartz, S., Yosef, N., Malboeuf, C., Lu, D., et al. (2013) · Nature · doi:10.1038/nature12172 · Cited by 1,190 · see citing works
Self-citationQuantitative single-cell RNA-seq with unique molecular identifiers
Islam, S., Zeisel, A., Joost, S., La Manno, G., Zajac, P., Kasper, M., Lönnerberg, P., & Linnarsson, S. (2014) · Nature Methods · doi:10.1038/nmeth.2772 · Cited by 1,183 · see citing works
The Neuronal Organization of the Retina
Masland, R. H. (2012) · Neuron · doi:10.1016/j.neuron.2012.10.002 · Cited by 1,155 · see citing works
Counting absolute numbers of molecules using unique molecular identifiers
Kivioja, T., Vähärautio, A., Karlsson, K., Bonke, M., Enge, M., Linnarsson, S., & Taipale, J. (2012) · Nature Methods · doi:10.1038/nmeth.1778 · Cited by 1,010 · see citing works
Single-cell RNA-seq reveals dynamic paracrine control of cellular variation
Shalek, A. K., Satija, R., Shuga, J., Trombetta, J. J., Gennert, D., Lu, D., Chen, P., Gertner, R. S., Gaublomme, J. T., Yosef, N., et al. (2014) · Nature · doi:10.1038/nature13437 · Cited by 1,000 · see citing works
Self-citationAccounting for technical noise in single-cell RNA-seq experiments
Brennecke, P., Anders, S., Kim, J. K., Kołodziejczyk, A. A., Zhang, X., Proserpio, V., Baying, B., Benes, V., Teichmann, S. A., Marioni, J. C., et al. (2013) · Nature Methods · doi:10.1038/nmeth.2645 · Cited by 979 · see citing works
Dripping to Jetting Transitions in Coflowing Liquid Streams
Utada, A. S., Fernández‐Nieves, A., Stone, H. A., & Weitz, D. A. (2007) · Physical Review Letters · doi:10.1103/physrevlett.99.094502 · Cited by 967 · see citing works
Self-citationThe Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification
Sanes, J. R., & Masland, R. H. (2015) · Annual Review of Neuroscience · doi:10.1146/annurev-neuro-071714-034120 · Cited by 789 · see citing works
Self-citationZhu, Y., Machleder, E. M., Chenchik, A. A., Li, R., & Siebert, P. D. (2001) · BioTechniques · doi:10.2144/01304pf02 · Cited by 773 · see citing works
Genetic Dissection of Neural Circuits
Luo, L., Callaway, E. M., & Svoboda, K. (2008) · Neuron · doi:10.1016/j.neuron.2008.01.002 · Cited by 754 · see citing works
Monodisperse Emulsion Generation via Drop Break Off in a Coflowing Stream
Umbanhowar, P. B., Prasad, V., & Weitz, D. A. (1999) · Langmuir · doi:10.1021/la990101e · Cited by 700 · see citing works
Self-citationRods and cones in the mouse retina. I. Structural analysis using light and electron microscopy
Carter‐Dawson, L. D., & LaVail, M. M. (1979) · The Journal of Comparative Neurology · doi:10.1002/cne.901880204 · Cited by 695 · see citing works
Mapping the stereotyped behaviour of freely moving fruit flies
Berman, G. J., Choi, D. M., Bialek, W., & Shaevitz, J. W. (2014) · Journal of The Royal Society Interface · doi:10.1098/rsif.2014.0672 · Cited by 565 · see citing works
Design Principles of Insect and Vertebrate Visual Systems
Sanes, J. R., & Zipursky, S. L. (2010) · Neuron · doi:10.1016/j.neuron.2010.01.018 · Cited by 559 · see citing works
Self-citationBarres, B. A., Silverstein, B. E., Corey, D. P., & Chun, L. L. Y. (1988) · Neuron · doi:10.1016/0896-6273(88)90127-4 · Cited by 520 · see citing works
Data exploration, quality control and testing in single-cell qPCR-based gene expression experiments
McDavid, A., Finak, G., Chattopadyay, P. K., Dominguez, M., Lamoreaux, L., Ma, S. S., Roederer, M., & Gottardo, R. (2013) · Bioinformatics · doi:10.1093/bioinformatics/bts714 · Cited by 395 · see citing works
Transcriptional code and disease map for adult retinal cell types
Siegert, S., Cabuy, E., Scherf, B. G., Kohler, H., Panda, S., Le, Y.-Z., Fehling, H. J., Gaidatzis, D., Stadler, M. B., & Roska, B. (2012) · Nature Neuroscience · doi:10.1038/nn.3032 · Cited by 253 · see citing works
Statistical significance of variables driving systematic variation in high-dimensional data
Chung, N. C., & Storey, J. D. (2014) · Bioinformatics · doi:10.1093/bioinformatics/btu674 · Cited by 247 · see citing works
Automatic Classification of Cellular Expression by Nonlinear Stochastic Embedding (ACCENSE)
Shekhar, K., Brodin, P., Davis, M. M., & Chakraborty, A. K. (2013) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1321405111 · Cited by 215 · see citing works
Self-citationOn-Chip Single-Copy Real-Time Reverse-Transcription PCR in Isolated Picoliter Droplets
Beer, N. R., Wheeler, E. K., Lee-Houghton, L., Watkins, N. N., Nasarabadi, S., Hebert, N. E., Leung, P., Arnold, D. W., Bailey, C. G., & Colston, B. W. (2008) · Analytical Chemistry · doi:10.1021/ac800048k · Cited by 209 · see citing works
Expression of Neuronal Connexin36 in AII Amacrine Cells of the Mammalian Retina
Feigenspan, A., Teubner, B., Willecke, K., & Weiler, R. (2001) · Journal of Neuroscience · doi:10.1523/jneurosci.21-01-00230.2001 · Cited by 207 · see citing works
Bar‐Joseph, Z., Siegfried, Z., Brandeis, M., Brors, B., Lu, Y. C., Eils, R., Dynlacht, B. D., & Simon, I. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0704723105 · Cited by 162 · see citing works
Neurod6 expression defines new retinal amacrine cell subtypes and regulates their fate
Kay, J. N., Voinescu, P. E., Chu, M. W., & Sanes, J. R. (2011) · Nature Neuroscience · doi:10.1038/nn.2859 · Cited by 119 · see citing works
Self-citationHaverkamp, S., & Wässle, H. (2004) · Journal of Comparative Neurology · doi:10.1002/cne.10962 · Cited by 110 · see citing works
Yang, Y., & Cvekl, A. (2005) · Journal of Molecular Biology · doi:10.1016/j.jmb.2005.05.072 · Cited by 62 · see citing works
Tbr2 Is Required to Generate a Neural Circuit Mediating the Pupillary Light Reflex
Sweeney, N. T., Tierney, H. R., & Feldheim, D. A. (2014) · Journal of Neuroscience · doi:10.1523/jneurosci.0035-14.2014 · Cited by 54 · see citing works
Differential transport of DNA by a rectified Brownian motion device
Hammond, R. W., Bader, J. S., Henck, S. A., Deem, M. W., McDermott, G. A., Bustillo, J. M., & Rothberg, J. M. (2000) · Electrophoresis · doi:10.1002/(sici)1522-2683(20000101)21:1 · Cited by 37 · see citing works
Gelatinase B/matrix metalloproteinase‐9 provokes cataract by cleaving lens βB1 crystallin
Descamps, F. J., Martens, E., Proost, P., et al. (2005) · The FASEB Journal · doi:10.1096/fj.04-1837com · Cited by 30 · see citing works
The Joint Null Criterion for Multiple Hypothesis Tests
Leek, J. T., & Storey, J. D. (2011) · Statistical Applications in Genetics and Molecular Biology · doi:10.2202/1544-6115.1673 · Cited by 26 · see citing works
Famiglietti, E. V., & Sundquist, S. J. (2010) · Visual Neuroscience · doi:10.1017/s0952523810000052 · Cited by 14 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
Integrating single-cell transcriptomic data across different conditions, technologies, and species
Butler, A., Hoffman, P., Smibert, P., Papalexi, E., & Satija, R. (2018) · Nature Biotechnology · doi:10.1038/nbt.4096 · Cited by 13,174 · see citing works
Self-citationSCANPY: large-scale single-cell gene expression data analysis
Wolf, F. A., Angerer, P., & Theis, F. J. (2018) · Genome Biology · doi:10.1186/s13059-017-1382-0 · Cited by 8,881 · see citing works
Massively parallel digital transcriptional profiling of single cells
Zheng, G. X. Y., Terry, J. M., Belgrader, P., Ryvkin, P., Bent, Z. W., Wilson, R., Ziraldo, S. B., Wheeler, T. D., McDermott, G. P., Zhu, J., et al. (2017) · Nature Communications · doi:10.1038/ncomms14049 · Cited by 7,353 · see citing works
Scenic: single-cell regulatory network inference and clustering.
Aibar, S., González-Blas, C. B., Moerman, T., Huynh-Thu, V. A., Imrichova, H., Hulselmans, G., Rambow, F., Marine, J.-C., Geurts, P., Aerts, J., et al. (2017) · Nature Methods · doi:10.1038/nmeth.4463 · Cited by 6,520 · see citing works
Aran, D., Looney, A. P., Liu, L., Wu, E., Fong, V., Hsu, A., Chak, S., Naikawadi, R. P., Wolters, P. J., Abate, A. R., et al. (2019) · Nature Immunology · doi:10.1038/s41590-018-0276-y · Cited by 4,984 · see citing works
Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq
Tirosh, I., Izar, B., Prakadan, S. M., Wadsworth, M. H., Treacy, D., Trombetta, J. J., Rotem, A., Rodman, C., Lian, C., Murphy, G., et al. (2016) · Science · doi:10.1126/science.aad0501 · Cited by 4,944 · see citing works
Self-citationMcGinnis, C. S., Murrow, L. M., & Gartner, Z. J. (2019) · Cell Systems · doi:10.1016/j.cels.2019.03.003 · Cited by 4,521 · see citing works
Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells
Klein, A. M., Mazutis, L., Akartuna, I., Tallapragada, N., Veres, A., Li, V., Peshkin, L., Weitz, D. A., & Kirschner, M. W. (2015) · Cell · doi:10.1016/j.cell.2015.04.044 · Cited by 3,356 · see citing works
Self-citationSimultaneous epitope and transcriptome measurement in single cells
Stoeckius, M., Hafemeister, C., Stephenson, W., Houck-Loomis, B., Chattopadhyay, P. K., Swerdlow, H., Satija, R., & Smibert, P. (2017) · Nature Methods · doi:10.1038/nmeth.4380 · Cited by 3,098 · see citing works
Self-citationSingle-cell transcriptomics of 20 mouse organs creates a Tabula Muris
The Tabula Muris Consortium, coordination, O., coordination, L., processing, O. C. A., sequencing, L. P. A., analysis, C. D., annotation, C. T., Writing group, Supplemental text writing group, & Principal investigators (2018) · Nature · doi:10.1038/s41586-018-0590-4 · Cited by 3,326 · see citing works
Scrublet: computational identification of cell doublets in single-cell transcriptomic data
Wolock, S. L., Lopez, R., & Klein, A. M. (2019) · Cell Systems · doi:10.1016/j.cels.2018.11.005 · Cited by 2,758 · see citing works
Molecular Architecture of the Mouse Nervous System
Zeisel, A., Hochgerner, H., Lönnerberg, P., Johnsson, A., Memic, F., van der Zwan, J., Häring, M., Braun, E., Borm, L. E., La Manno, G., et al. (2018) · Cell · doi:10.1016/j.cell.2018.06.021 · Cited by 2,995 · see citing works
Generalizing RNA velocity to transient cell states through dynamical modeling
Bergen, V., Lange, M., Peidli, S., Wolf, F. A., & Theis, F. J. (2020) · Nature Biotechnology · doi:10.1038/s41587-020-0591-3 · Cited by 2,951 · see citing works
Single-cell transcriptomic analysis of Alzheimer’s disease
Mathys, H., Davila-Velderrain, J., Peng, Z., Gao, F., Mohammadi, S., Young, J. Z., Menon, M., He, L., Abdurrob, F., Jiang, X., et al. (2019) · Nature · doi:10.1038/s41586-019-1195-2 · Cited by 2,568 · see citing works
VEGF in signaling and disease: beyond discovery and development
Apte, R. S., Chen, D. S., & Ferrara, N. (2019) · Cell · doi:10.1016/j.cell.2019.01.021 · Cited by 2,721 · see citing works
A survey of best practices for RNA-seq data analysis
Conesa, A., Madrigal, P., Tarazona, S., Gomez-Cabrero, D., Cervera, A., McPherson, A., Szcześniak, M. W., Gaffney, D. J., Elo, L. L., Zhang, X., et al. (2016) · Genome Biology · doi:10.1186/s13059-016-0881-8 · Cited by 2,794 · see citing works
Slide-seq: A scalable technology for measuring genome-wide expression at high spatial resolution
Rodriques, S. G., Stickels, R. R., Goeva, A., Martin, C. A., Murray, E., Vanderburg, C. R., Welch, J., Chen, L. M., Chen, F., & Macosko, E. Z. (2019) · Science · doi:10.1126/science.aaw1219 · Cited by 2,424 · see citing works
Self-citationDeep generative modeling for single-cell transcriptomics
Lopez, R., Regier, J., Cole, M. B., Jordan, M. I., & Yosef, N. (2018) · Nature Methods · doi:10.1038/s41592-018-0229-2 · Cited by 2,530 · see citing works
Ziegler, C. G. K., Allon, S. J., Nyquist, S. K., Mbano, I. M., Miao, V. N., Tzouanas, C. N., Cao, Y., Yousif, A. S., Bals, J., Hauser, B. M., et al. (2020) · Cell · doi:10.1016/j.cell.2020.04.035 · Cited by 2,284 · see citing works
Self-citationRegev, A., Teichmann, S. A., Lander, E. S., Amit, I., Benoist, C., Birney, E., Bodenmiller, B., Campbell, P., Carninci, P., Clatworthy, M., et al. (2017) · eLife · doi:10.7554/elife.27041 · Cited by 2,232 · see citing works
Self-citationBatch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors
Haghverdi, L., Lun, A. T. L., Morgan, M. D., & Marioni, J. C. (2018) · Nature Biotechnology · doi:10.1038/nbt.4091 · Cited by 2,416 · see citing works
Single-cell RNA-seq reveals new types of human blood dendritic cells, monocytes, and progenitors
Villani, A.-C., Satija, R., Reynolds, G., Sarkizova, S., Shekhar, K., Fletcher, J., Griesbeck, M., Butler, A., Zheng, S., Lazo, S., et al. (2017) · Science · doi:10.1126/science.aah4573 · Cited by 2,413 · see citing works
Self-citationElyada, E., Bolisetty, M., Laise, P., Flynn, W. F., Courtois, E. T., Burkhart, R. A., Teinor, J. A., Belleau, P., Biffi, G., Lucito, M. S., et al. (2019) · Cancer Discovery · doi:10.1158/2159-8290.cd-19-0094 · Cited by 2,241 · see citing works
Current best practices in single-cell RNA-seq analysis: a tutorial
Luecken, M. D., & Theis, F. J. (2019) · Molecular Systems Biology · doi:10.15252/msb.20188746 · Cited by 2,231 · see citing works
Hammond, T. R., Dufort, C., Dissing-Olesen, L., Giera, S., Young, A., Wysoker, A., Walker, A. J., Segel, M., Nemesh, J., Saunders, A., et al. (2018) · doi:10.1101/406140 · Cited by 2,225 · see citing works
Self-citationMetastatic colonization by circulating tumour cells
Massagué, J., & Obenauf, A. C. (2016) · Nature · doi:10.1038/nature17038 · Cited by 2,062 · see citing works
Shared and distinct transcriptomic cell types across neocortical areas
Tasic, B., Yao, Z., Graybuck, L. T., Smith, K. A., Nguyen, T. N., Bertagnolli, D., Goldy, J., Garren, E., Economo, M. N., Viswanathan, S., et al. (2018) · Nature · doi:10.1038/s41586-018-0654-5 · Cited by 1,746 · see citing works
Dixit, A., Parnas, O., Li, B., Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., Burks, T., Raychowdhury, R., et al. (2016) · Cell · doi:10.1016/j.cell.2016.11.038 · Cited by 1,863 · see citing works
Self-citationMcCarthy, D. J., Campbell, K. R., Lun, A. T. L., & Wills, Q. F. (2017) · Bioinformatics · doi:10.1093/bioinformatics/btw777 · Cited by 1,852 · see citing works
Molecular diversity and specializations among the cells of the adult mouse brain
Saunders, A., Macosko, E. Z., Wysoker, A., Goldman, M., Krienen, F. M., de Rivera, H., Bien, E., Baum, M., Bortolin, L., Wang, S., et al. (2018) · Cell · doi:10.1016/j.cell.2018.07.028 · Cited by 1,847 · see citing works
“…AGATCTACACGCCT GTCCGCGGAAGCAGTGGTATCAACGCAGAGT* A*C Macosko et al., 2015 N/A Read1CustomSeqB: GCCTGTCCGCGGAAGCA GTGGTATCAACGCAG AGTAC Macosko et al., 2015 N/A Software and Algorithms Drop-seq_tools Macosko et al., 2015 http://mccarrolllab.com/dropseq/ IcaCluster This paper…”
InfluentialSelf-citationThree-dimensional intact-tissue sequencing of single-cell transcriptional states
Wang, X., Allen, W. E., Wright, M. A., Sylwestrak, E. L., Samusik, N., Vesuna, S., Evans, K., Liu, C., Ramakrishnan, C., Liu, J., et al. (2018) · Science · doi:10.1126/science.aat5691 · Cited by 1,620 · see citing works
Microglia emerge as central players in brain disease
Salter, M. W., & Stevens, B. (2017) · Nature Medicine · doi:10.1038/nm.4397 · Cited by 1,767 · see citing works
Mapping the Mouse Cell Atlas by Microwell-Seq
Han, X., Wang, R., Zhou, Y., Fei, L., Sun, H., Lai, S., Saadatpour, A., Zhou, Z., Chen, H., Ye, F., et al. (2018) · Cell · doi:10.1016/j.cell.2018.02.001 · Cited by 1,597 · see citing works
Adult mouse cortical cell taxonomy revealed by single cell transcriptomics
Tasic, B., Menon, V., Nguyen, T. N., Kim, T. K., Jarsky, T., Yao, Z., Levi, B., Gray, L. T., Sorensen, S. A., Dolbeare, T., et al. (2016) · Nature Neuroscience · doi:10.1038/nn.4216 · Cited by 1,714 · see citing works
Single cell RNA sequencing of human liver reveals distinct intrahepatic macrophage populations
MacParland, S. A., Liu, J. C., Ma, X.-Z., Innes, B. T., Bartczak, A. M., Gage, B. K., Manuel, J., Khuu, N., Echeverri, J., Linares, I., et al. (2018) · Nature Communications · doi:10.1038/s41467-018-06318-7 · Cited by 1,552 · see citing works
Comparative Analysis of Single-Cell RNA Sequencing Methods
Ziegenhain, C., Vieth, B., Parekh, S., Reinius, B., Guillaumet-Adkins, A., Smets, M., Leonhardt, H., Heyn, H., Hellmann, I., & Enard, W. (2017) · Molecular Cell · doi:10.1016/j.molcel.2017.01.023 · Cited by 1,494 · see citing works
SoupX removes ambient RNA contamination from droplet-based single-cell RNA sequencing data
Young, M. D., & Behjati, S. (2020) · GigaScience · doi:10.1093/gigascience/giaa151 · Cited by 1,619 · see citing works
“We next investigate the properties of ambient RNA contamination in data where ground truth is available, the “speciesmixing” experiments combining mouse and human cell lines using 10X [2] and Drop-Seq technologies [14].”
InfluentialCao, J., Packer, J. S., Ramani, V., Cusanovich, D. A., Huynh, C., Daza, R., Qiu, X., Lee, C., Furlan, S. N., Steemers, F. J., et al. (2017) · doi:10.1101/104844 · Cited by 1,402 · see citing works
Diffusion pseudotime robustly reconstructs lineage branching
Haghverdi, L., Büttner, M., Wolf, F. A., Buettner, F., & Theis, F. J. (2016) · Nature Methods · doi:10.1038/nmeth.3971 · Cited by 1,385 · see citing works
Molecular, spatial, and functional single-cell profiling of the hypothalamic preoptic region
Moffitt, J. R., Bambah-Mukku, D., Eichhorn, S. W., Vaughn, E., Shekhar, K., Perez, J. D., Rubinstein, N. D., Hao, J., Regev, A., Dulac, C., et al. (2018) · Science · doi:10.1126/science.aau5324 · Cited by 1,365 · see citing works
Self-citationSingle-cell profiling of the developing mouse brain and spinal cord with split-pool barcoding
Rosenberg, A. B., Roco, C. M., Muscat, R. A., Kuchina, A., Sample, P., Yao, Z., Graybuck, L. T., Peeler, D. J., Mukherjee, S., Chen, W., et al. (2018) · Science · doi:10.1126/science.aam8999 · Cited by 1,422 · see citing works
PanglaoDB: a web server for exploration of mouse and human single-cell RNA sequencing data
Franzén, O., Gan, L.-M., & Björkegren, J. L. M. (2019) · Database · doi:10.1093/database/baz046 · Cited by 1,551 · see citing works
Eleven grand challenges in single-cell data science
Lähnemann, D., Köster, J., Szczurek, E., McCarthy, D. J., Hicks, S. C., Robinson, M. D., Vallejos, C. A., Campbell, K. R., Beerenwinkel, N., Mahfouz, A., et al. (2020) · Genome Biology · doi:10.1186/s13059-020-1926-6 · Cited by 1,327 · see citing works
Single-cell genome sequencing: current state of the science
Gawad, C., Koh, W., & Quake, S. R. (2016) · Nature Reviews Genetics · doi:10.1038/nrg.2015.16 · Cited by 1,334 · see citing works
Integrative single-cell analysis
Stuart, T., & Satija, R. (2019) · Nature Reviews Genetics · doi:10.1038/s41576-019-0093-7 · Cited by 1,460 · see citing works
Self-citationSingle-Cell Multi-omic Integration Compares and Contrasts Features of Brain Cell Identity
Welch, J. D., Kozareva, V., Ferreira, A., Vanderburg, C., Martin, C., & Macosko, E. Z. (2019) · Cell · doi:10.1016/j.cell.2019.05.006 · Cited by 1,193 · see citing works
Self-citationCell diversity and network dynamics in photosensitive human brain organoids
Quadrato, G., Nguyen, T., Macosko, E. Z., Sherwood, J. L., Min Yang, S., Berger, D. R., Maria, N., Scholvin, J., Goldman, M., Kinney, J. P., et al. (2017) · Nature · doi:10.1038/nature22047 · Cited by 1,321 · see citing works
Self-citationAssembly of functionally integrated human forebrain spheroids
Birey, F., Andersen, J., Makinson, C. D., Islam, S., Wei, W., Huber, N., Fan, H. C., Metzler, K. R. C., Panagiotakos, G., Thom, N., et al. (2017) · Nature · doi:10.1038/nature22330 · Cited by 1,365 · see citing works
Multiplexed droplet single-cell RNA-sequencing using natural genetic variation
Kang, H. M., Subramaniam, M., Targ, S., Nguyen, M., Maliskova, L., McCarthy, E., Wan, E., Wong, S., Byrnes, L., Lanata, C. M., et al. (2018) · Nature Biotechnology · doi:10.1038/nbt.4042 · Cited by 1,339 · see citing works
“Let ecvi ∈ {0, 1} be a latent variable indicating whether the base call is correct (0) or not (1), then given ecvi = 0, bcvi ∈ {R = 0, A = 1} and ∼ Binomial 2 2 , g when g ∈ {0, 1, 2} is the true genotype of the sample corresponding to c-th droplet at v-th variant.”
BackgroundNASH limits anti-tumour surveillance in immunotherapy-treated HCC
Pfister, D., Núñez, N. G., Pinyol, R., Govaere, O., Pinter, M., Szydlowska, M., Gupta, R., Qiu, M., Deczkowska, A., Weiner, A., et al. (2021) · Nature · doi:10.1038/s41586-021-03362-0 · Cited by 1,294 · see citing works
Highly sensitive spatial transcriptomics at near-cellular resolution with Slide-seqV2
Stickels, R. R., Murray, E., Kumar, P., Li, J., Marshall, J. L., Di Bella, D. J., Arlotta, P., Macosko, E. Z., & Chen, F. (2021) · Nature Biotechnology · doi:10.1038/s41587-020-0739-1 · Cited by 1,295 · see citing works
Self-citationCEL-seq2: sensitive highly-multiplexed single-cell RNA-Seq
Hashimshony, T., Senderovich, N., Avital, G., Klochendler, A., de Leeuw, Y., Anavy, L., Gennert, D., Li, S., Livak, K. J., Rozenblatt-Rosen, O., et al. (2016) · Genome Biology · doi:10.1186/s13059-016-0938-8 · Cited by 1,125 · see citing works
Self-citationHigh-definition spatial transcriptomics for in situ tissue profiling
Vickovic, S., Eraslan, G., Salmén, F., Klughammer, J., Stenbeck, L., Schapiro, D., Äijö, T., Bonneau, R., Bergenstråhle, L., Navarro, J. F., et al. (2019) · Nature Methods · doi:10.1038/s41592-019-0548-y · Cited by 1,150 · see citing works
Self-citationA benchmark of batch-effect correction methods for single-cell RNA sequencing data
Tran, H. T. N., Ang, K. S., Chevrier, M., Zhang, X., Lee, N. Y. S., Goh, M., & Chen, J. (2020) · Genome Biology · doi:10.1186/s13059-019-1850-9 · Cited by 1,113 · see citing works
Massively parallel single-nucleus RNA-seq with DroNc-seq
Habib, N., Avraham-Davidi, I., Basu, A., Burks, T., Shekhar, K., Hofree, M., Choudhury, S. R., Aguet, F., Gelfand, E., Ardlie, K., et al. (2017) · Nature Methods · doi:10.1038/nmeth.4407 · Cited by 1,069 · see citing works
Self-citationAdamson, B., Norman, T. M., Jost, M., Cho, M. Y., Nuñez, J. K., Chen, Y., Villalta, J. E., Gilbert, L. A., Horlbeck, M. A., Hein, M. Y., et al. (2016) · Cell · doi:10.1016/j.cell.2016.11.048 · Cited by 1,193 · see citing works
Self-citationHuman cerebral organoids recapitulate gene expression programs of fetal neocortex development
Camp, J. G., Badsha, F., Florio, M., Kanton, S., Gerber, T., Wilsch-Bräuninger, M., Lewitus, E., Sykes, A., Hevers, W., Lancaster, M., et al. (2015) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1520760112 · Cited by 1,130 · see citing works
Reyfman, P. A., Walter, J. M., Joshi, N., Anekalla, K. R., McQuattie-Pimentel, A. C., Chiu, S., Fernandez, R., Akbarpour, M., Chen, C.-I., Ren, Z., et al. (2019) · American Journal of Respiratory and Critical Care Medicine · doi:10.1164/rccm.201712-2410oc · Cited by 1,203 · see citing works
Pooled CRISPR screening with single-cell transcriptome readout.
Datlinger, P., Rendeiro, A. F., Schmidl, C., Krausgruber, T., Traxler, P., Klughammer, J., Schuster, L. C., Kuchler, A., Alpar, D., & Bock, C. (2017) · Nature Methods · doi:10.1038/nmeth.4177 · Cited by 1,096 · see citing works
Brann, D. H., Tsukahara, T., Weinreb, C., Lipovsek, M., Van den Berge, K., Gong, B., Chance, R., Macaulay, I. C., Chou, H.-J., Fletcher, R. B., et al. (2020) · Science Advances · doi:10.1126/sciadv.abc5801 · Cited by 1,198 · see citing works
A practical guide to single-cell RNA-sequencing for biomedical research and clinical applications
Haque, A., Engel, J., Teichmann, S. A., & Lönnberg, T. (2017) · Genome Medicine · doi:10.1186/s13073-017-0467-4 · Cited by 1,071 · see citing works
Jacob, F., Salinas, R. D., Zhang, D. Y., Nguyen, P. T. T., Schnoll, J. G., Wong, S. Z. H., Thokala, R., Sheikh, S., Saxena, D., Prokop, S., et al. (2020) · Cell · doi:10.1016/j.cell.2019.11.036 · Cited by 1,149 · see citing works
Comprehensive Classification of Retinal Bipolar Neurons by Single-Cell Transcriptomics
Shekhar, K., Lapan, S. W., Whitney, I. E., Tran, N. M., Macosko, E. Z., Kowalczyk, M., Adiconis, X., Levin, J. Z., Nemesh, J., Goldman, M., et al. (2016) · Cell · doi:10.1016/j.cell.2016.07.054 · Cited by 1,176 · see citing works
Self-citationHabermann, A. C., Gutierrez, A. J., Bui, L. T., Yahn, S. L., Winters, N. I., Calvi, C. L., Peter, L., Chung, M.-I., Taylor, C. J., Jetter, C., et al. (2020) · Science Advances · doi:10.1126/sciadv.aba1972 · Cited by 1,129 · see citing works
Li, Q., Cheng, Z., Zhou, L., Darmanis, S., Neff, N. F., Okamoto, J., Gulati, G., Bennett, M. L., Sun, L. O., Clarke, L. E., et al. (2019) · Neuron · doi:10.1016/j.neuron.2018.12.006 · Cited by 1,129 · see citing works
Pooling across cells to normalize single-cell RNA sequencing data with many zero counts
L. Lun, A. T., Bach, K., & Marioni, J. C. (2016) · Genome Biology · doi:10.1186/s13059-016-0947-7 · Cited by 1,108 · see citing works
Neuronal subtypes and diversity revealed by single-nucleus RNA sequencing of the human brain
Lake, B. B., Ai, R., Kaeser, G. E., Salathia, N. S., Yung, Y. C., Liu, R., Wildberg, A., Gao, D., Fung, H.-L., Chen, S., et al. (2016) · Science · doi:10.1126/science.aaf1204 · Cited by 957 · see citing works
Single-cell RNA-seq denoising using a deep count autoencoder
Eraslan, G., Simon, L. M., Mircea, M., Mueller, N. S., & Theis, F. J. (2019) · Nature Communications · doi:10.1038/s41467-018-07931-2 · Cited by 1,084 · see citing works
Construction of a human cell landscape at single-cell level
Han, X., Zhou, Z., Fei, L., Sun, H., Wang, R., Chen, Y., Chen, H., Wang, J., Tang, H., Ge, W., et al. (2020) · Nature · doi:10.1038/s41586-020-2157-4 · Cited by 1,087 · see citing works
Single-cell RNA-seq enables comprehensive tumour and immune cell profiling in primary breast cancer
Chung, W., Eum, H. H., Lee, H.-O., Lee, K.-M., Lee, H.-B., Kim, K.-T., Ryu, H. S., Kim, S., Lee, J. E., Park, Y. H., et al. (2017) · Nature Communications · doi:10.1038/ncomms15081 · Cited by 992 · see citing works
Gene co-expression analysis for functional classification and gene–disease predictions
van Dam, S., Võsa, U., van der Graaf, A., Franke, L., & de Magalhães, J. P. (2017) · Briefings in Bioinformatics · doi:10.1093/bib/bbw139 · Cited by 1,086 · see citing works
The technological landscape and applications of single-cell multi-omics
Baysoy, A., Bai, Z., Satija, R., & Fan, R. (2023) · Nature Reviews Molecular Cell Biology · doi:10.1038/s41580-023-00615-w · Cited by 1,037 · see citing works
Self-citationHigh-Spatial-Resolution Multi-Omics Sequencing via Deterministic Barcoding in Tissue
Liu, Y., Yang, M., Deng, Y., Su, G., Enninful, A., Guo, C. C., Tebaldi, T., Zhang, D., Kim, D., Bai, Z., et al. (2020) · Cell · doi:10.1016/j.cell.2020.10.026 · Cited by 966 · see citing works
Kathleen Cuningham Foundation Consortium for Research into Familial Breast Cancer (kConFab), Savas, P., Virassamy, B., Ye, C., Salim, A., Mintoff, C. P., Caramia, F., Salgado, R., Byrne, D. J., Teo, Z. L., et al. (2018) · Nature Medicine · doi:10.1038/s41591-018-0078-7 · Cited by 992 · see citing works
Genetic and transcriptional evolution alters cancer cell line drug response
Ben-David, U., Siranosian, B., Ha, G., Tang, H., Oren, Y., Hinohara, K., Strathdee, C. A., Dempster, J., Lyons, N. J., Burns, R., et al. (2018) · Nature · doi:10.1038/s41586-018-0409-3 · Cited by 931 · see citing works
Systematic comparison of single-cell and single-nucleus RNA-sequencing methods
Ding, J., Adiconis, X., Simmons, S. K., Kowalczyk, M. S., Hession, C. C., Marjanovic, N. D., Hughes, T. K., Wadsworth, M. H., Burks, T., Nguyen, L. T., et al. (2020) · Nature Biotechnology · doi:10.1038/s41587-020-0465-8 · Cited by 871 · see citing works
Self-citationThe functional diversity of retinal ganglion cells in the mouse
Baden, T., Berens, P., Franke, K., Román Rosón, M., Bethge, M., & Euler, T. (2016) · Nature · doi:10.1038/nature16468 · Cited by 999 · see citing works
Integrative single-cell analysis of transcriptional and epigenetic states in the human adult brain
Lake, B. B., Chen, S., Sos, B. C., Fan, J., Kaeser, G. E., Yung, Y. C., Duong, T. E., Gao, D., Chun, J., Kharchenko, P. V., et al. (2018) · Nature Biotechnology · doi:10.1038/nbt.4038 · Cited by 983 · see citing works
Deep learning and alignment of spatially resolved single-cell transcriptomes with Tangram
Biancalani, T., Scalia, G., Buffoni, L., Avasthi, R., Lu, Z., Sanger, A., Tokcan, N., Vanderburg, C. R., Segerstolpe, Å., Zhang, M., et al. (2021) · Nature Methods · doi:10.1038/s41592-021-01264-7 · Cited by 931 · see citing works
Self-citationGarris, C. S., Arlauckas, S. P., Kohler, R. H., Trefny, M. P., Garren, S., Piot, C., Engblom, C., Pfirschke, C., Siwicki, M., Gungabeesoon, J., et al. (2018) · Immunity · doi:10.1016/j.immuni.2018.09.024 · Cited by 966 · see citing works
The bone marrow microenvironment at single-cell resolution
Tikhonova, A. N., Dolgalev, I., Hu, H., Sivaraj, K. K., Hoxha, E., Cuesta-Domínguez, Á., Pinho, S., Akhmetzyanova, I., Gao, J., Witkowski, M., et al. (2019) · Nature · doi:10.1038/s41586-019-1104-8 · Cited by 936 · see citing works
Self-citationSatpathy, A. T., Granja, J. M., Yost, K. E., Qi, Y., Meschi, F., McDermott, G. P., Olsen, B. N., Mumbach, M. R., Pierce, S. E., Corces, M. R., et al. (2019) · Nature Biotechnology · doi:10.1038/s41587-019-0206-z · Cited by 980 · see citing works
Single-cell mapping of gene expression landscapes and lineage in the zebrafish embryo
Wagner, D. E., Weinreb, C., Collins, Z. M., Briggs, J. A., Megason, S. G., & Klein, A. M. (2018) · Science · doi:10.1126/science.aar4362 · Cited by 849 · see citing works
High-throughput sequencing of the transcriptome and chromatin accessibility in the same cell
Chen, S., Lake, B. B., & Zhang, K. (2019) · Nature Biotechnology · doi:10.1038/s41587-019-0290-0 · Cited by 810 · see citing works
Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state
Rotem, A., Ram, O., Shoresh, N., Sperling, R. A., Goren, A., Weitz, D. A., & Bernstein, B. E. (2015) · Nature Biotechnology · doi:10.1038/nbt.3383 · Cited by 854 · see citing works
Self-citationCochain, C., Vafadarnejad, E., Arampatzi, P., Pelisek, J., Winkels, H., Ley, K., Wolf, D., Saliba, A.-E., & Zernecke, A. (2018) · Circulation Research · doi:10.1161/circresaha.117.312509 · Cited by 894 · see citing works
Multiplexed quantification of proteins and transcripts in single cells
Peterson, V. M., Zhang, K. X., Kumar, N., Wong, J., Li, L., Wilson, D. C., Moore, R., McClanahan, T. K., Sadekova, S., & Klappenbach, J. A. (2017) · Nature Biotechnology · doi:10.1038/nbt.3973 · Cited by 832 · see citing works
Bias, robustness and scalability in single-cell differential expression analysis
Soneson, C., & Robinson, M. D. (2018) · Nature Methods · doi:10.1038/nmeth.4612 · Cited by 770 · see citing works
A cellular census of human lungs identifies novel cell states in health and in asthma
Vieira Braga, F. A., Kar, G., Berg, M., Carpaij, O. A., Polanski, K., Simon, L. M., Brouwer, S., Gomes, T., Hesse, L., Jiang, J., et al. (2019) · Nature Medicine · doi:10.1038/s41591-019-0468-5 · Cited by 896 · see citing works
Effect of the intratumoral microbiota on spatial and cellular heterogeneity in cancer
Galeano Niño, J. L., Wu, H., LaCourse, K. D., Kempchinsky, A. G., Baryiames, A., Barber, B., Futran, N., Houlton, J., Sather, C., Sicinska, E., et al. (2022) · Nature · doi:10.1038/s41586-022-05435-0 · Cited by 887 · see citing works
Kowalczyk, M. S., Tirosh, I., Heckl, D., Rao, T. N., Dixit, A., Haas, B. J., Schneider, R. K., Wagers, A. J., Ebert, B. L., & Regev, A. (2015) · Genome Research · doi:10.1101/gr.192237.115 · Cited by 778 · see citing works
Self-citationA draft network of ligand–receptor-mediated multicellular signalling in human
Ramilowski, J. A., Goldberg, T., Harshbarger, J., Kloppmann, E., Lizio, M., Satagopam, V. P., Itoh, M., Kawaji, H., Carninci, P., Rost, B., et al. (2015) · Nature Communications · doi:10.1038/ncomms8866 · Cited by 887 · see citing works
A molecular census of arcuate hypothalamus and median eminence cell types
Campbell, J. N., Macosko, E. Z., Fenselau, H., Pers, T. H., Lyubetskaya, A., Tenen, D., Goldman, M., Verstegen, A. M. J., Resch, J. M., McCarroll, S. A., et al. (2017) · Nature Neuroscience · doi:10.1038/nn.4495 · Cited by 817 · see citing works
Self-citationSingle-cell reconstruction of developmental trajectories during zebrafish embryogenesis
Farrell, J. A., Wang, Y., Riesenfeld, S. J., Shekhar, K., Regev, A., & Schier, A. F. (2018) · Science · doi:10.1126/science.aar3131 · Cited by 876 · see citing works
Self-citationThe Types of Retinal Ganglion Cells: Current Status and Implications for Neuronal Classification
Sanes, J. R., & Masland, R. H. (2015) · Annual Review of Neuroscience · doi:10.1146/annurev-neuro-071714-034120 · Cited by 789 · see citing works
Self-citationHe, S., Bhatt, R., Brown, C., Brown, E. A., Buhr, D. L., Chantranuvatana, K., Danaher, P., Dunaway, D., Garrison, R. G., Geiss, G., et al. (2022) · Nature Biotechnology · doi:10.1038/s41587-022-01483-z · Cited by 814 · see citing works
Llorens-Bobadilla, E., Zhao, S., Baser, A., Saiz-Castro, G., Zwadlo, K., & Martin-Villalba, A. (2015) · Cell Stem Cell · doi:10.1016/j.stem.2015.07.002 · Cited by 778 · see citing works
The role of myeloid cells in cancer therapies
Engblom, C., Pfirschke, C., & Pittet, M. J. (2016) · Nature Reviews Cancer · doi:10.1038/nrc.2016.54 · Cited by 788 · see citing works
Classification of low quality cells from single-cell RNA-seq data
Ilicic, T., Kim, J. K., Kolodziejczyk, A. A., Bagger, F. O., McCarthy, D. J., Marioni, J. C., & Teichmann, S. A. (2016) · Genome Biology · doi:10.1186/s13059-016-0888-1 · Cited by 693 · see citing works
Tsukui, T., Sun, K.-H., Wetter, J. B., Wilson-Kanamori, J. R., Hazelwood, L. A., Henderson, N. C., Adams, T. S., Schupp, J. C., Poli, S. D., Rosas, I. O., et al. (2020) · Nature Communications · doi:10.1038/s41467-020-15647-5 · Cited by 765 · see citing works
- Authors
- Macosko, E. Z., Basu, A., Satija, R., Nemesh, J., Shekhar, K., Goldman, M., Tirosh, I., Bialas, A. R., Kamitaki, N., Martersteck, E. M., Trombetta, J. J., Weitz, D. A., Sanes, J. R., Shalek, A. K., Regev, A., & McCarroll, S. A.
- Affiliations
- Broad Institute (US)
- Boston Children's Hospital (US)
- Harvard University (US)
- Corresponding author
- Macosko, Evan Z.
- McCarroll, Steven A.
- ORCID
- Venue
- Cell
- Publisher
- Elsevier BV
- Published
- 2015-05
- Volume
- 161
- Issue
- 5
- Pages
- 1202-1214
- ISSN
- 0092-8674 (ISSN-L)
- PMC
- PMC4481139
- OpenAlex
- W2102212449
- Semantic Scholar
- 9227690267ab90da9a0af109e170537ce843cd5d
- Cited by
- 7,110
- References
- 48
- Citations by year
- 2026: 445 · 2025: 567 · 2024: 698 · 2023: 761 · 2022: 789 · 2021: 902 · 2020: 854 · 2019: 710 · 2018: 642 · 2017: 413 · 2016: 245 · 2015: 67 · 2014: 3 · 2013: 4 · 2012: 2
- FWCI
- 198.33
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Licence
- Locations
- Cell (publishedVersion)
- PubMed (publishedVersion)
- Europe PMC (PubMed Central) (acceptedVersion)
- PubMed Central (acceptedVersion)
- DSpace@MIT (Massachusetts Institute of Technology) (submittedVersion, cc-by-nc-nd)
- eScholarship (California Digital Library) (submittedVersion)
- eScholarship (California Digital Library) (submittedVersion, cc-by-nc-nd)
- Funders
- National Science Foundation (ECS- 03-35765, 1310266, 0335765, 1420570)
- Howard Hughes Medical Institute
- Alexander and Margaret Stewart Trust
- National Institutes of Health (ECS-0335765, DMR-1420570)
- Materials Research Science and Engineering Center, Harvard University (DMR- 1420570, 1420570, DMR-1310266)
- Stanley Center for Psychiatric Research, Broad Institute
- Klarman Cell Observatory, Broad Institute
- Simons Center for the Social Brain, Massachusetts Institute of Technology
- National Institute of Mental Health (R25MH094612, U01MH105960)
- National Human Genome Research Institute (P50HG006193, HG006193)
- National Institute of Allergy and Infectious Diseases (T32AI074549)
- National Institute of Diabetes and Digestive and Kidney Diseases (P30DK043351)
- Division of Materials Research (DMR 14–20570, DMR-1310266, 1420570, 1310266)
- Eunice Kennedy Shriver National Institute of Child Health and Human Development (F32HD075541)
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Single-cell and spatial transcriptomics
- Physical Sciences › Engineering › Biomedical Engineering › Innovative Microfluidic and Catalytic Techniques Innovation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Genomics and Phylogenetic Studies
- Keywords
- Drop-seq, single-cell transcriptomics, nanoliter droplets, cell barcoding, mRNA sequencing, retinal cell types, retinal transcriptome, cell subtypes, molecular atlas, mouse retina
- MeSH terms
- Animals, Retina, Sequence Analysis, RNA, Gene Expression Profiling, Microfluidic Analytical Techniques, Mice, Genome-Wide Association Study, Single-Cell Analysis, High-Throughput Nucleotide Sequencing
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
