The DOI matches its Crossref record; 57 of the 65 references it cites were found in a registry or an index; none of the 60 sources its claims cite is checked for support yet.
Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia
Open accessAbstract
The brain has emerged as a target for the insulin-sensitizing effects of several hormonal and nutrient-related signals. The current studies were undertaken to investigate mechanisms whereby leptin lowers circulating blood glucose levels independently of insulin. After extending previous evidence that leptin infusion directly into the lateral cerebral ventricle ameliorates hyperglycemia in rats with streptozotocin-induced uncontrolled diabetes mellitus, we showed that the underlying mechanism is independent of changes of food intake, urinary glucose excretion, or recovery of pancreatic β-cells. Instead, leptin action in the brain potently suppresses hepatic glucose production while increasing tissue glucose uptake despite persistent, severe insulin deficiency. This leptin action is distinct from its previously reported effect to increase insulin sensitivity in the liver and offers compelling evidence that the brain has the capacity to normalize diabetic hyperglycemia in the presence of sufficient amounts of central nervous system leptin.
Overview
AI snapshot
Written from the paper’s full text.
TL;DR
In streptozotocin-induced uncontrolled diabetic rats, intracerebroventricular leptin normalized blood glucose by day 7 independently of food intake, urinary glucose loss, or pancreatic β-cell recovery. The effect involved insulin-independent suppression of hepatic glucose production and increased tissue glucose uptake, with normalization of plasma glucagon and corticosterone.
Key findings
- Intracerebroventricular leptin (1 g/d) normalized blood glucose by day 7 in STZ-diabetic rats, whereas subcutaneous leptin at the same dose did not; pair feeding to leptin-treated intake also did not attenuate hyperglycemia.
- Urinary glucose was undetectable in icv leptin-treated diabetic rats versus marked glycosuria in STZ-veh rats; plasma insulin remained very low, pancreatic preproinsulin mRNA was reduced by >95%, and glucose tolerance was near normal despite no increase in circulating insulin.
- Tracer studies showed icv leptin reduced glucose appearance/HGP to nondiabetic values and increased glucose uptake in red gastrocnemius muscle, brain, BAT, and heart; during a hyperglycemic clamp at approximately 210 mg/dl, HGP was suppressed and glucose utilization increased despite severe insulin deficiency.
- Hepatic G6Pase and Pepck expression was reduced by icv leptin; plasma glucagon and corticosterone elevations in STZ diabetes were prevented by icv leptin; hepatic Igfbp2 mRNA was increased >25-fold in diabetic rats and further increased by leptin, which the authors argue is unlikely to explain the HGP effect.
Methods
- Adult male Wistar rats received two daily sc injections of STZ (40 mg/kg body weight) to induce uncontrolled diabetes, plus lateral ventricle cannula and sc osmotic minipump for icv vehicle or leptin (1 g/d) for up to 11 days; five groups (n = 7–9 per group): veh-veh, STZ-veh, STZ-leptin, STZ-veh-pair-fed, and STZ-leptin-sc.
- Daily food intake, body weight, water intake, and blood glucose were measured; ip glucose tolerance tests (2 g/kg) were performed on day 9; arterial catheters were used for plasma glucagon, corticosterone, and catecholamine measurements.
- Glucose turnover was assessed with [3-3H]glucose and 2[14C]deoxyglucose tracer dilution, including a hyperglycemic clamp at approximately 210 mg/dl; hepatic gene expression was measured by real-time PCR, and liver triglyceride/glycogen and body composition were also analyzed.
Limitations
- The paper states that Rd could not be compared between icv leptin-treated and veh-treated STZ-diabetic rats because glycosuria confounds Rd; it also states that whether reduced glucagon contributes to, or results from, leptin-mediated resolution of hyperglycemia is unknown, and that mechanisms of leptin regulation of the hypothalamic-pituitary-adrenal axis remain incompletely understood.
- The paper states that autonomic/SNS involvement is suspected but not directly tested here; it notes that prior denervation or adrenergic blockade studies did not measure Rg.
- Evident from the text: findings are limited to male Wistar rats with STZ-induced diabetes and short-term central leptin infusion, so human type 1 diabetes and long-term outcomes are not established; causal roles of glucagon and corticosterone normalization are not definitively separated from other mechanisms.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
41 Own result · 36 Not checked yet · 18 Own interpretation · 3 No basis given · 1 Own method
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Plasma corticosterone levels were similarly elevated in animals with STZ diabetes, a response also prevented by icv leptin but not PF (Fig. 6B).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes plasma glucagon and corticosterone levels in STZ-induced diabetes
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Although the action of leptin in the CNS was also associated with normalization of elevated plasma glucagon levels, consistent with an earlier report (4), our data suggest that factors, in addition to glucagon, contribute to the glucoselowering effect of CNS leptin action.”
- Also stated in: § CNS leptin infusion normalizes plasma glucagon and corticosterone levels in STZ-induced diabetes · plain
“the elevation in plasma glucagon levels observed in STZ-treated animals was prevented by central leptin administration (Fig. 6A).”
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § CNS leptin infusion normalizes plasma glucagon and corticosterone levels in STZ-induced diabetes · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“leptin action in the brain potently suppresses hepatic glucose production while increasing tissue glucose uptake despite persistent, severe insulin deficiency.”
- Also stated in: § Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes · plain
“glucose uptake was significantly increased in red gastrocnemius muscle and brain in STZdiabetic animals that received icv leptin relative to veh (Fig. 3C).”
- Also stated in: § Discussion · boosted
“we demonstrate that leptin acts in the CNS to potently inhibit glucose production and simultaneously increase tissue glucose utilization in diabetic animals.”
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we showed that the underlying mechanism is independent of changes of food intake, urinary glucose excretion, or recovery of pancreatic -cells.”
- Also stated in: § CNS leptin infusion normalizes blood glucose levels in STZ-induced diabetes · plain
“This effect was due neither to a leptin-mediated reversal of diabetic hyperphagia, because hyperglycemia was not attenuated in STZ-veh-PF animals”
- Also stated in: § Discussion · plain
“via a mechanism that cannot be explained by reduced food intake, increased urinary glucose losses, or recovery of pancreatic -cells”
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § CNS leptin infusion normalizes blood glucose levels in STZ-induced diabetes · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“leptin action in the brain potently suppresses hepatic glucose production while increasing tissue glucose uptake despite persistent, severe insulin deficiency.”
- Also stated in: § Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes · hedged
“Central leptin administration dramatically reduced Ra to nondiabetic control values (Fig. 3A), strongly suggesting that normalization of diabetic hyperglycemia resulted, at least in part, from reduced HGP.”
- Also stated in: § Discussion · boosted
“we demonstrate that leptin acts in the CNS to potently inhibit glucose production and simultaneously increase tissue glucose utilization in diabetic animals.”
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes · hedged
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“By comparison, hepatic expression of these genes was significantly reduced in STZ-diabetic rats receiving icv leptin”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we showed that the underlying mechanism is independent of changes of food intake, urinary glucose excretion, or recovery of pancreatic -cells.”
- Also stated in: § Potential mechanism(s) mediating the glucose-lowering action of CNS leptin · plain
“the severe insulin deficiency (under both basal and glucose-stimulated conditions) caused by STZ-induced -cell destruction was not ameliorated by icv leptin.”
- Also stated in: § Discussion · plain
“via a mechanism that cannot be explained by reduced food intake, increased urinary glucose losses, or recovery of pancreatic -cells”
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Potential mechanism(s) mediating the glucose-lowering action of CNS leptin · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“nor to a peripheral effect of leptin, because sc infusion of leptin at the same dose did not affect blood glucose in STZ-diabetic rats (Fig. 1D).”
- Also stated in: § Discussion · plain
“does not involve a peripheral action of leptin.”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes blood glucose levels in STZ-induced diabetes
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Discussion · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“we showed that the underlying mechanism is independent of changes of food intake, urinary glucose excretion, or recovery of pancreatic -cells.”
- Also stated in: § Potential mechanism(s) mediating the glucose-lowering action of CNS leptin · plain
“urinary glucose was undetectable in diabetic animals that received icv leptin similar to nondiabetic controls, whereas STZ-veh-treated animals displayed the expected, marked glycosuria (Fig. 2A).”
- Also stated in: § Discussion · plain
“via a mechanism that cannot be explained by reduced food intake, increased urinary glucose losses, or recovery of pancreatic -cells”
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- Also stated in: § Potential mechanism(s) mediating the glucose-lowering action of CNS leptin · plain
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“hepatic expression of the key gluconeogenic genes G6Pase and Pepck were markedly increased in the liver of STZ-veh-treated animals relative to nondiabetic controls (Fig. 4, A and B).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
- It may state two separate claims as one. 16
- Probably not a substantial claim. 4
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“plasma levels of NEFAs and ketone bodies were also elevated in STZ-veh animals and normalized with icv leptin administration but only after blood glucose levels had returned to normal (Fig. 6, E and F).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes plasma glucagon and corticosterone levels in STZ-induced diabetes
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“water intake was markedly increased in both groups of STZ-veh-treated animals, owing to the dehydrating effect of pronounced glycosuria in uDM (26), whereas water intake in diabetic animals receiving icv leptin was equivalent to that of nondiabetic controls (Fig. 2B).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Potential mechanism(s) mediating the glucose-lowering action of CNS leptin
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“leptin-treated STZ-diabetic rats exhibited similar weight loss to STZ-diabetic rats receiving icv veh but exhibited a greater loss of fat mass (Supplemental Fig. 1”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes blood glucose levels in STZ-induced diabetes
plaincorrelational- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“In nondiabetic animals, plasma insulin and C-peptide levels were significantly increased during the hyperglycemic clamp (P Ͻ 0.05) (Fig. 5, A and B), resulting in complete suppression of HGP and enhancement of glucose utilization by more than 250% (Fig. 5, E-H).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Similarly, despite persistent, severe insulin deficiency, HGP was suppressed and glucose utilization was increased in STZ-diabetic rats receiving icv leptin, although less than that observed in nondiabetic animals (Fig. 5, E-H).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Effect of icv leptin infusion on HGP and glucose uptake in STZ-induced diabetes
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“food intake was significantly increased by d 5 after STZ administration in diabetic animals receiving icv veh, and this effect was completely blocked by icv leptin (Fig. 1C).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes blood glucose levels in STZ-induced diabetes
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“We recently observed that in rats with STZ diabetes, physiological leptin replacement is sufficient to normalize plasma glucagon levels but has little effect on diabetic hyperglycemia (20).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
What the sources say
- Not checked yetcites [20] German, 2010, Leptin deficiency causes insulin resistance induced by uncontrolled diabetes., Diabetes source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“CNS leptin suppresses HGP and increases glucose utilization in uDM during a hyperglycemic clamp.”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A result the paper reports from its own data — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“CNS leptin normalizes plasma glucagon and corticosterone levels in uDM.”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“Although accumulating evidence suggests that leptin (10 -13), insulin (14,15), and nutrient-related signals (16 -18) in the CNS improve hepatic insulin sensitivity”
What the sources say
- Not checked yetcites [10] Liu, 1998, Intracerebroventricular leptin regulates hepatic but not peripheral glucose fluxes., J Biol Chem source
- Not checked yetcites [11] Pocai, 2005, Central leptin acutely reverses diet-induced hepatic insulin resistance., Diabetes source
- Not checked yetcites [12] Park, 2008, Long-term effects of central leptin and resistin on body weight, insulin resistance, and β-cell function and mass by the modulation of hypothalamic leptin and insulin signaling., Endocrinology source
- Not checked yetcites [13] German, 2009, Hypothalamic leptin signaling regulates hepatic insulin sensitivity via a neurocircuit involving the vagus nerve., Endocrinology source
- Not checked yetcites [14] Obici, 2002, Hypothalamic insulin signaling is required for inhibition of glucose production., Nat Med source
- Not checked yetcites [15] Pocai, 2005, Hypothalamic K(ATP) channels control hepatic glucose production., Nature source
- Not checked yetcites [16] Obici, 2002, Central administration of oleic acid inhibits glucose production and food intake., Diabetes source
- Not checked yetcites [17] Lam, 2005, Hypothalamic sensing of circulating fatty acids is required for glucose homeostasis., Nat Med source
- Not checked yetcites [18] Pocai, 2005, A brain-liver circuit regulates glucose homeostasis., Cell Metabolism source
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
None of the sources cited for this claim have been checked yet.
In the paper
“Several lines of evidence suggest that like leptin, insulin action in the brain of nondiabetic animals lowers ambient glycemia by increasing hepatic insulin sensitivity (14,15).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
What the sources say
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
In the paper
“leptin adminis-tration directly into the brain normalizes blood glucose in rats with uDM (5)(6)(7)(8)(9) at doses that are ineffective when administered peripherally.”
What the sources say
- Not checked yetcites 5)(6)(7)(8)(9
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These data suggest that icv leptin treatment reduces food intake and stimulates energy expenditure”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes blood glucose levels in STZ-induced diabetes
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: unclear — It is unclear whether the paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
In the paper
“we recently reported that in rats with STZ diabetes, physiological leptin replacement is sufficient to normalize cir-culating glucagon and corticosterone levels, yet does not reverse hyperglycemia (20).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes plasma glucagon and corticosterone levels in STZ-induced diabetes
What the sources say
- Not checked yetcites [20] German, 2010, Leptin deficiency causes insulin resistance induced by uncontrolled diabetes., Diabetes source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“hepatic Igfbp-2 expression is tonically inhibited by insulin and hence dramatically up-regulated by insulin deficiency (50 -52).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
What the sources say
- Not checked yetcites [50] Böni-Schnetzler, 1990, Insulin regulates the expression of the insulin-like growth factor binding protein 2 mRNA in rat hepatocytes., Mol Endocrinol source
- Not checked yetcites [51] Ooi, 1992, Post-transcriptional regulation of insulin-like growth factor binding protein-2 mRNA in diabetic rat liver., Biochem Biophys Res Commun source
- Not checked yetcites [52] White, 1993, Insulin-like growth-factor binding protein (IGFBP) serum levels and hepatic IGFBP-2 and -3 mRNA expression in diabetic and insulin-treated swine (Sus scrofa)., Comp Biochem Physiol B source
plaindirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“conditions associated with leptin deficiency, such as fasting and uDM, clearly raise corticosterone levels via a mechanism that can be reversed with leptin treatment (44,45,49).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
What the sources say
- Not checked yetcites [44] Schwartz, 1997, Evidence that elevated plasma corticosterone levels are the cause of reduced hypothalamic corticotrophin-releasing hormone gene expression in diabetes., Regul Pept source
- Not checked yetcites [45] Strack, 1995, Glucocorticoids and insulin: reciprocal signals for energy balance., Am J Physiol
- Not checked yetcites [49] Ahima, 1996, Role of leptin in the neuroendocrince response to fasting., Nature source
boosteddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
None of the sources cited for this claim have been checked yet.
In the paper
“suggesting a shared neuronal mechanism mediating effects of both hormones on glucose metabolism (34,35).”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
What the sources say
- Not checked yetcites [34] Obici, 2002, Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats., Nat Neurosci source
- Not checked yetcites [35] Morton, 2005, Leptin regulates insulin sensitivity via phosphatidylinositol-3-OH kinase signaling in mediobasal hypothalamic neurons., Cell Metab source
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: fails — The paper’s conclusions may not depend on it.
- Based: passes — The paper gives a reason why it holds.
Probably not a substantial claim. The paper’s conclusions may not depend on it.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“These observations are distinct from any previously described CNS leptin action”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: fails — The paper may give no reason why it holds.
Probably not a substantial claim. The paper may give no reason why it holds.
In the paper
“nor was activation of the 3-adrenergic receptors required or sufficient to mediate the effects of leptin on blood glucose levels (7)”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
What the sources say
- Not checked yetcites [7] da Silva, 2006, Chronic antidiabetic and cardiovascular actions of leptin: role of CNS and increased adrenergic activity., Am J Physiol Regul Integr Comp Physiol source
plain- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
A conclusion the paper draws from its own results — it cites no other source for it, so there is none to check. The quote shows it is in the paper.
In the paper
“Based on these data, we infer that icv leptin normalizes blood glucose levels in STZ-diabetic rats at least in part via an insulin-independent mechanism that increases glucose utilization in tissues such as BAT and skeletal muscle.”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
hedgeddirect- Asserted: passes — The authors put it forward as true.
- Checkable: passes — It can be checked against evidence.
- Load-bearing: passes — The paper’s conclusions depend on it.
- Based: passes — The paper gives a reason why it holds.
It may state two separate claims as one.
The authors state this as an assumption.
How CNS leptin signaling normalizes diabetic hyperglycemia in uDM, and whether this involves leptin-dependent effects on HGP or Rg, is unknown.
“how CNS leptin signaling normalizes diabetic hyperglycemia in uDM, and whether this involves leptin-dependent effects on hepatic glucose production (HGP) or tissue glucose uptake (Rg), is unknown.”
The paper relies on this without support.
Changes in plasma glucagon do not affect glucose utilization.
“an effect not readily explained by changes of plasma glucagon (which does not affect glucose utilization)”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“we recently found that continuous infusion of leptin directly into the brain normalizes blood glucose levels in STZ-induced diabetic rats via a mechanism that cannot be explained by reduced food intake, increased urinary glucose losses or a recovery of pancreatic β-cells.”
From Leptin and the Central Nervous System Control of Glucose Metabolism (2011) · cites this paper as [67]
In the citing paper
“This leptin action is distinct from its previously reported effect to increase insulin sensitivity in the liver (66, 146), and offers compelling evidence of a novel mechanism through which the brain normalizes diabetic hyperglycemia without the need for insulin (67).”
From Leptin and the Central Nervous System Control of Glucose Metabolism (2011) · cites this paper as [67]
In the citing paper
“Instead, leptin action in the brain potently suppressed hepatic glucose production while increasing tissue glucose uptake despite persistent, severe insulin deficiency (67).”
From Leptin and the Central Nervous System Control of Glucose Metabolism (2011) · cites this paper as [67]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Rated minor: it would not touch a result — a value no result rests on, a p-value that stays on the same side of the significance level, or a conflict that is clerical, resolved elsewhere in the paper, or outside its own findings.
In the paper
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > CNS leptin infusion normalizes plasma glucagon and corticosterone levels in STZ-induced diabetes
“Although changes in plasma norepinephrine and epinephrine levels are unlikely to explain leptin's effects (Fig. 6, A and D)”
§ Leptin Activates a Novel CNS Mechanism for Insulin-Independent Normalization of Severe Diabetic Hyperglycemia > Discussion
“Plasma glucagon (A), plasma corticosterone (B), norepinephrine (NE) (C), epinephrine (EPI) (D)”
Citations
Cites
The rat brain in stereotaxic coordinates
Palkovits, M. (1983) · Neuropeptides · doi:10.1016/0143-4179(83)90049-5 · Cited by 28,959
The Rat Brain in Stereotaxic Coordinates
Paxinos, G., & Watson, C. (1983) · Elsevier eBooks · doi:10.1016/c2009-0-63235-9 · Cited by 28,585
Role of leptin in the neuroendocrine response to fasting
Ahima, R. S., Prabakaran, D., Mantzoros, C., Qu, D., Lowell, B., Maratos-Flier, E., & Flier, J. S. (1996) · Nature · doi:10.1038/382250a0 · Cited by 3,117
Hypothalamic insulin signaling is required for inhibition of glucose production
Obici, S., Zhang, B. B., Karkanias, G., & Rossetti, L. (2002) · Nature Medicine · doi:10.1038/nm1202-798 · Cited by 904
Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats
Obici, S., Feng, Z., Karkanias, G., Baskin, D. G., & Rossetti, L. (2002) · Nature Neuroscience · doi:10.1038/nn0602-861 · Cited by 719
RIZZA, R. A., MANDARINO, L. J., & GERICH, J. E. (1982) · The Journal of Clinical Endocrinology & Metabolism · doi:10.1210/jcem-54-1-131 · Cited by 696
Central Administration of Oleic Acid Inhibits Glucose Production and Food Intake
Obici, S., Feng, Z., Morgan, K., Stein, D., Karkanias, G., & Rossetti, L. (2002) · Diabetes · doi:10.2337/diabetes.51.2.271 · Cited by 654
Hypothalamic KATP channels control hepatic glucose production
Pocai, A., Lam, T. K. T., Gutierrez-Juarez, R., Obici, S., Schwartz, G. J., Bryan, J., Aguilar-Bryan, L., & Rossetti, L. (2005) · Nature · doi:10.1038/nature03439 · Cited by 645
Decreasing hypothalamic insulin receptors causes hyperphagia and insulin resistance in rats
Obici, S., Feng, Z., Karkanias, G. B., et al. (2002) · Nature Neuroscience · doi:10.1038/nn861 · Cited by 572
DeFronzo, R. A., Simonson, D. C., & Ferrannini, E. (1982) · Diabetologia · doi:10.1007/bf00253736 · Cited by 539
Hypothalamic sensing of circulating fatty acids is required for glucose homeostasis
Lam, T. K. T., Pocai, A., Gutierrez-Juarez, R., Obici, S., Bryan, J., Aguilar-Bryan, L., Schwartz, G. J., & Rossetti, L. (2005) · Nature Medicine · doi:10.1038/nm1201 · Cited by 432
Dose-response curves for in vivo insulin sensitivity in individual tissues in rats
Kraegen, E. W., James, D. E., Jenkins, A. B., & Chisholm, D. J. (1985) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.1985.248.3.e353 · Cited by 409
A brain-liver circuit regulates glucose homeostasis
Pocai, A., Obici, S., Schwartz, G. J., & Rossetti, L. (2005) · Cell Metabolism · doi:10.1016/j.cmet.2004.11.001 · Cited by 392
Hill, J. W., Elias, C. F., Fukuda, M., Williams, K. W., Berglund, E. D., Holland, W. L., Cho, Y.-R., Chuang, J.-C., Xu, Y., Choi, M., et al. (2010) · Cell Metabolism · doi:10.1016/j.cmet.2010.03.002 · Cited by 391
Leptin increases uncoupling protein expression and energy expenditure
Scarpace, P. J., Matheny, M. E., Pollock, B. H., & Tümer, N. (1997) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.1997.273.1.e226 · Cited by 390
Sipols, A. J., Baskin, D. G., & Schwartz, M. W. (1995) · Diabetes · doi:10.2337/diab.44.2.147 · Cited by 389 · cited 1×
“blood glucose levels in STZ-diabetic rats (36),”
Self-citationLocal Ventromedial Hypothalamus Glucopenia Triggers Counterregulatory Hormone Release
Borg, W. P., Sherwin, R. S., During, M. J., Borg, M. A., & Shulman, G. I. (1995) · Diabetes · doi:10.2337/diab.44.2.180 · Cited by 386
Borg, M. A., Sherwin, R. S., Borg, W. P., Tamborlane, W. V., & Shulman, G. I. (1997) · Journal of Clinical Investigation · doi:10.1172/jci119165 · Cited by 359
Williams, K. W., Margatho, L. O., Lee, C. E., Choi, M., Lee, S., Scott, M. M., Elias, C. F., & Elmquist, J. K. (2010) · The Journal of Neuroscience · doi:10.1523/jneurosci.3118-09.2010 · Cited by 352
Glucocorticoids and insulin: reciprocal signals for energy balance
Strack, A. M., Sebastian, R. J., Schwartz, M. W., & Dallman, M. F. (1995) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.1995.268.1.r142 · Cited by 330
Self-citationMinokoshi, Y., Haque, M. S., & Shimazu, T. (1999) · Diabetes · doi:10.2337/diabetes.48.2.287 · Cited by 302
Morton, G. J., Gelling, R. W., Niswender, K. D., Morrison, C. D., Rhodes, C. J., & Schwartz, M. W. (2005) · Cell Metabolism · doi:10.1016/j.cmet.2005.10.009 · Cited by 292
Self-citationAntidiabetic Effects of IGFBP2, a Leptin-Regulated Gene
Hedbacker, K., Birsoy, K., Wysocki, R. W., Asilmaz, E., Ahima, R. S., Farooqi, I. S., & Friedman, J. M. (2010) · Cell Metabolism · doi:10.1016/j.cmet.2009.11.007 · Cited by 280
Ventromedial hypothalamic lesions in rats suppress counterregulatory responses to hypoglycemia.
Borg, W. P., During, M. J., Sherwin, R. S., Borg, M. A., Brines, M. L., & Shulman, G. I. (1994) · Journal of Clinical Investigation · doi:10.1172/jci117150 · Cited by 265
The effect of experimental insulin deficiency on glucagon secretion
Müller, W. A., Faloona, G. R., & Unger, R. H. (1971) · Journal of Clinical Investigation · doi:10.1172/jci106691 · Cited by 240
Glucagon: Role in the Hyperglycemia of Diabetes Mellitus
Dobbs, R., Sakurai, H., Sasaki, H., Faloona, G., Valverde, I., Baetens, D., Orci, L., & Unger, R. (1975) · Science · doi:10.1126/science.1089999 · Cited by 229
Intracerebroventricular Leptin Regulates Hepatic but Not Peripheral Glucose Fluxes
Liu, L., Karkanias, G. B., Morales, J. C., Hawkins, M., Barzilai, N., Wang, J., & Rossetti, L. (1998) · Journal of Biological Chemistry · doi:10.1074/jbc.273.47.31160 · Cited by 222
Making insulin-deficient type 1 diabetic rodents thrive without insulin
Yu, X., Park, B.-H., Wang, M.-Y., Wang, Z. V., & Unger, R. H. (2008) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0806993105 · Cited by 219
Haque, M. S., Minokoshi, Y., Hamai, M., Iwai, M., Horiuchi, M., & Shimazu, T. (1999) · Diabetes · doi:10.2337/diabetes.48.9.1706 · Cited by 215 · cited 1×
“Consistent with this hypothesis, leptin administration directly into the brain of nondiabetic rats stimulates glucose uptake in BAT, as well as skeletal muscle and heart, by increasing SNS outflow (55, 56).”
BackgroundLeptin induction of UCP1 gene expression is dependent on sympathetic innervation
Scarpace, P. J., & Matheny, M. E. (1998) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.1998.275.2.e259 · Cited by 203
Baskin, D. G., Schwartz, M. W., Seeley, R. J., Woods, S. C., Porte, D., Breininger, J. F., Jonak, Z., Schaefer, J., Krouse, M., Burghardt, C., et al. (1999) · Journal of Histochemistry & Cytochemistry · doi:10.1177/002215549904700309 · Cited by 200
Self-citationHavel, P. J., Uriu-Hare, J. Y., Liu, T., Stanhope, K. L., Stern, J. S., Keen, C. L., & Ahrén, B. (1998) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.1998.274.5.r1482 · Cited by 198
Leptin restores euglycemia and normalizes glucose turnover in insulin-deficient diabetes in the rat.
Chinookoswong, N., Wang, J. L., & Shi, Z. Q. (1999) · Diabetes · doi:10.2337/diabetes.48.7.1487 · Cited by 197 · cited 1×
“tion of leptin systemically (3, 4) can also normalize blood”
BackgroundSplanchnic regulation of glucose production
Wahren, J., & Ekberg, K. (2007) · Annual Review of Nutrition · doi:10.1146/annurev.nutr.27.061406.093806 · Cited by 185
Evans, M. I., Halter, J. B., & Porte, D. (1978) · Clinical Chemistry · doi:10.1093/clinchem/24.4.567 · Cited by 180
Effect of Insulin on Utilization and Production of Circulating Glucose
Wall, J. S., Steele, R., de Bodo, R. C., & ALTSZULER, N. (1957) · American Journal of Physiology-Legacy Content · doi:10.1152/ajplegacy.1957.189.1.43 · Cited by 180
German, J., Kim, F., Schwartz, G. J., Havel, P. J., Rhodes, C. J., Schwartz, M. W., & Morton, G. J. (2009) · Endocrinology · doi:10.1210/en.2009-0445 · Cited by 164
Self-citationLeptin Deficiency Causes Insulin Resistance Induced by Uncontrolled Diabetes
German, J. P., Wisse, B. E., Thaler, J. P., Oh-I, S., Sarruf, D. A., Ogimoto, K., Kaiyala, K. J., Fischer, J. D., Matsen, M. E., Taborsky, G. J., et al. (2010) · Diabetes · doi:10.2337/db09-1918 · Cited by 159
Self-citationCentral Leptin Acutely Reverses Diet-Induced Hepatic Insulin Resistance
Pocai, A., Morgan, K., Buettner, C., Gutierrez-Juarez, R., Obici, S., & Rossetti, L. (2005) · Diabetes · doi:10.2337/diabetes.54.11.3182 · Cited by 153
Regulation of gluconeogenesis by glucocorticoids.
Exton, J. H. (1979) · Monographs on endocrinology · doi:10.1007/978-3-642-81265-1_28 · Cited by 130 · cited 6×
“The primer sequences for 18S RNA, G6Pase, Pepck, and Igfbp-2 were designed using Primer Express (version 2.0.0; Applied Biosystems) and are as follows: 18S RNA forward, CGGACAGGATTGACAGATTG and reverse, CAAATCGCTCCACCAACTAA; G6Pase forward, TCAACCTCGTCTTCAAGTGGATT and reverse, CTGCTTTATTATAGGCACGGAGCT; Pepck forward,…”
BackgroundInfluentialCentral leptin increases insulin sensitivity in streptozotocin-induced diabetic rats
Lin, C.-Y., Higginbotham, D. A., Judd, R. L., & White, B. D. (2002) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00489.2001 · Cited by 124
Low plasma leptin levels contribute to diabetic hyperphagia in rats.
Sindelar, D. K., Havel, P. J., Seeley, R. J., Wilkinson, C. W., Woods, S. C., & Schwartz, M. W. (1999) · Diabetes · doi:10.2337/diabetes.48.6.1275 · Cited by 119
Self-citationSCRIBNER, K. A., WALKER, C.-D., CASCIO, C. S., & DALLMAN, M. F. (1991) · Endocrinology · doi:10.1210/endo-129-1-99 · Cited by 112
Hidaka, S., Yoshimatsu, H., Kondou, S., Tsuruta, Y., Oka, K., Noguchi, H., Okamoto, K., Sakino, H., Teshima, Y., Okeda, T., et al. (2002) · The FASEB Journal · doi:10.1096/fj.01-0164com · Cited by 108
Böni-Schnetzler, M., Schmid, C., Mary, J.-L., Zimmerli, B., Meier, P. J., Zapf, J., Schwander, J., & Froesch, E. R. (1990) · Molecular Endocrinology · doi:10.1210/mend-4-9-1320 · Cited by 80
Banting, F., & BEST, C. H. (1990) · PubMed · Cited by 75
Park, S., Hong, S. M., Sung, S. R., & Jung, H. K. (2008) · Endocrinology · doi:10.1210/en.2007-0754 · Cited by 73
Glucocorticoids and hepatic glycogen metabolism.
Stalmans, W., & Laloux, M. (1979) · Monographs on endocrinology · doi:10.1007/978-3-642-81265-1_27 · Cited by 65
Schwartz, M. W., Strack, A. M., & Dallman, M. F. (1997) · Regulatory Peptides · doi:10.1016/s0167-0115(97)01043-4 · Cited by 57
Self-citationChari, M., Lam, C. K. L., Wang, P. Y. T., & Lam, T. K. T. (2008) · Diabetes · doi:10.2337/db07-1464 · Cited by 53
da Silva, A. A., Tallam, L. S., Liu, J., & Hall, J. E. (2006) · American Journal of Physiology-Regulatory, Integrative and Comparative Physiology · doi:10.1152/ajpregu.00187.2006 · Cited by 51
Castleman’s Disease Presenting as a Goiter in a Child
Kukuvitis, A., Gompakis, N., Zafeiriou, D., et al. (2003) · Hormone Research in Paediatrics · doi:10.1159/000067931 · Cited by 48
Kojima, S., Asakawa, A., Amitani, H., Sakoguchi, T., Ueno, N., Inui, A., & Kalra, S. P. (2009) · Peptides · doi:10.1016/j.peptides.2009.01.007 · Cited by 47
Ooi, G. T., Y.-H. Tseng, L., & Rechler, M. M. (1992) · Biochemical and Biophysical Research Communications · doi:10.1016/0006-291x(92)92307-j · Cited by 21
White, M. E., Leaman, D. W., Ramsay, T. G., Kampman, K. A., Ernst, C. W., & Osborne, J. M. (1993) · Comparative Biochemistry and Physiology Part B Comparative Biochemistry · doi:10.1016/0305-0491(93)90311-r · Cited by 8
Wang, J., Wernette, C. M., Judd, R. L., Huggins, K. W., & White, B. D. (2008) · Journal of Endocrinology · doi:10.1677/joe-08-0135 · Cited by 8
Elmquist (1998) · doi:10.1002/(sici)1096-9861(19980615)395:4
Research works printed but not linked: 1
- Maghnie, 2003, Diabetes insipidus., Horm Res, 59, 42
Cited by
Sorted by citations
Thyroid Hormone Regulation of Metabolism
Mullur, R., Liu, Y.-Y., & Brent, G. A. (2014) · Physiological Reviews · doi:10.1152/physrev.00030.2013 · Cited by 2,421
The pathogenesis of insulin resistance: integrating signaling pathways and substrate flux
Samuel, V. T., & Shulman, G. I. (2016) · Journal of Clinical Investigation · doi:10.1172/jci77812 · Cited by 1,484
Neurobiology of food intake in health and disease
Morton, G. J., Meek, T. H., & Schwartz, M. W. (2014) · Nature Reviews Neuroscience · doi:10.1038/nrn3745 · Cited by 748
Self-citationPhysiology of leptin: energy homeostasis, neuroendocrine function and metabolism
Park, H. K., & Ahima, R. S. (2014) · Metabolism · doi:10.1016/j.metabol.2014.08.004 · Cited by 710
“Leptin potently suppresses hepatic glucose production partly by ameliorating hyperglucagonemia and increases peripheral glucose uptake, via multiple mechanisms including POMC- and AgRP-expressing neurons in the ARC [105–108].”
BackgroundLeptin in Human Physiology and Pathophysiology
Mantzoros, C. S., Magkos, F., Brinkoetter, M., Sienkiewicz, E., Dardeno, T. A., Kim, S.-Y., Hamnvik, O.-P. R., & Koniaris, A. (2011) · American Journal of Physiology-Endocrinology and Metabolism · doi:10.1152/ajpendo.00315.2011 · Cited by 593
Metadata
- Authors
- German, J. P., Thaler, J. P., Wisse, B. E., Oh-I, S., Sarruf, D. A., Matsen, M. E., Fischer, J. D., Taborsky, G. J., Schwartz, M. W., & Morton, G. J.
- Affiliations
- University of Washington (US)
- Diabetes and Obesity Center of Excellence (J.P.G., J.P.T., B.E.W., S.O.-I., D.A.S., M.E.M., J.D.F., M.W.S., G.J.M.), Department of Medicine, University of Washington, Seattle, Washington 98109
- VA Puget Sound Health Care System (US)
- Corresponding author
- Morton, Gregory J.
- Venue
- Endocrinology
- Publisher
- The Endocrine Society
- Published
- 2010-12-15
- Volume
- 152
- Issue
- 2
- Pages
- 394-404
- ISSN
- 0013-7227 (ISSN-L)
- 1945-7170
- PMC
- PMC3037161
- OpenAlex
- W1996800212
- Semantic Scholar
- 7c46f9454e2b40dacf481b15d5c0a823b6dc64a7
- Cited by
- 169
- References
- 65
- Citations by year
- 2026: 1 · 2025: 8 · 2024: 7 · 2023: 4 · 2022: 7 · 2021: 12 · 2020: 10 · 2019: 10 · 2018: 6 · 2017: 14 · 2016: 18 · 2015: 23 · 2014: 14 · 2013: 16 · 2012: 11
- FWCI
- 4.94
- Type
- journal article
- Language
- en
- Open access
- bronze
- doi.org
- Locations
- Endocrinology (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Funders
- U.S. Department of Veterans Affairs
- University of Washington
- National Institutes of Health (1u24dk076126-01)
- National Institute of Diabetes and Digestive and Kidney Diseases (R01DK074758, DK-083042, U24-DK076126, DK 035816, DK-050154-13, R56DK050154, R01DK050154, R01DK090320, P30DK035816, R01DK083042)
- Topics
- Life Sciences › Neuroscience › Endocrine and Autonomic Systems › Regulation of Appetite and Obesity
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Pancreatic function and diabetes
- Health Sciences › Medicine › Endocrinology, Diabetes and Metabolism › Adipokines, Inflammation, and Metabolic Diseases
- Keywords
- leptin, diabetic hyperglycemia, insulin-independent glucose regulation, hepatic glucose production, tissue glucose uptake, streptozotocin-induced diabetes, insulin deficiency
- MeSH terms
- Animals, Blood Glucose, Body Composition, Brain, Corticosterone, Diabetes Mellitus, Experimental, Glucagon, Glucose Tolerance Test, Hyperglycemia, Insulin, Male, Rats, Wistar, Reverse Transcriptase Polymerase Chain Reaction, Leptin, Rats
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
A language model drew the claims from the paper on 2026-10-10, under version 3 of the claim definition (model deepseek-v4.1-flash, prompt extract-v3).
A second model labelled each claim on 2026-10-10 (model jev-1.13-20260917, definition revision gold-guideline-v0.2).
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
