Genetic variation in CCDC93 is associated with elevated central systolic blood pressure, impaired arterial relaxation, and mitochondrial dysfunction

Probably not a substantial claim.

A mixed linear model considering kinship was performed using EMMAX, a statistical test for large-scale human or model organism association mapping that accounts for sample structure.

“A mixed linear model considering kinship was performed using the EMMAX program [84], which is a statistical test for large scale human or model organism association mapping accounting for the sample structure.”

• cites [84] HM Kang, 2010, Variance component model to account for sample structure in genome-wide association studies, Nat Genet sourcePartly supported

  The Discussion (page not provided) identifies EMMAX as an expedited mixed linear model that accounts for kinship and corrects sample structure in human GWASs. The paper demonstrates EMMAX on human datasets; it mentions similar approaches in animal models but does not establish EMMAX as a test for model-organism association mapping. (LLM, conf=0.84)

  Experimental — accuracy not yet measured

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Xdh-derived ROS are proinflammatory in the vasculature as they increase vascular permeability and arteriolar tone and thus promote hypertension, cardiovascular diseases, and atherosclerosis.

“Xdh-derived ROS are proinflammatory in the vasculature as they increase vascular permeability and arteriolar tone [57] and thus promote hypertension, cardiovascular diseases, and atherosclerosis [58,59].”

• cites [57] H Cai, 2000, Endothelial dysfunction in cardiovascular diseases: the role of oxidant stress, Circ Res sourcePartly supported

  The Xanthine Oxidase section (page not provided) links xanthine oxidase–derived superoxide to blood pressure in hypertensive rats and to early experimental atherosclerosis. The Abstract also links oxidant stress broadly to cardiovascular disease. But the paper distinguishes xanthine dehydrogenase from xanthine oxidase and does not establish the disease-promoting claim specifically for dehydrogenase-derived ROS. (LLM, conf=0.83)

  Experimental — accuracy not yet measured
• cites [58] MG Battelli, 2014, Xanthine oxidoreductase in atherosclerosis pathogenesis: not only oxidative stress, Atherosclerosis sourceNot checked — no full text of the source
• cites [59] SM Ghosh, 2013, Enhanced vasodilator activity of nitrite in hypertension: critical role for erythrocytic xanthine oxidoreductase and translational potential, Hypertension sourceNot checked — no full text of the source

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Parkin is an E3-ubiquitous ligase that accumulates on the outer membrane of damaged mitochondria, ubiquitinates mitochondrial outer membrane proteins, and activates mitochondria for autophagy and degradation in lysosomes.

“The protein Parkin is a E3-ubiquitous ligase that accumulates on the outer membrane of damaged mitochondria which ubiquitinates mitochondrial outer membrane proteins [65,66], and activates mitochondria for autophagy and degradation in lysosomes [67].”

• cites [65] P Ge, 2020, PINK1 and Parkin mitochondrial quality control: a source of regional vulnerability in Parkinson’s disease., Mol Neurodegener. sourceCheck pending
• cites [66] DJ Tyrrell, 2020, Aging Impairs Mitochondrial Function and Mitophagy and Elevates Interleukin 6 Within the Cerebral Vasculature., J Am Heart Assoc sourceCheck pending
• cites [67] D Narendra, 2008, Parkin is recruited selectively to impaired mitochondria and promotes their autophagy, J Cell Biol sourceSupported

It may state two separate claims as one.

A genetic risk score based on published SBP and DBP GWAS results was significantly associated with SBP (β = 0.68, SE = 0.06, P = 3.42×10−30) and DBP (β = 0.59, SE = 0.06, P = 2.5×10−24) in the study cohort.

“significant associations were identified with SBP (GRS-association of 611 SNPs β = 0.68, SE = 0.06, P = 3.42×10−30) and DBP (GRS-association of 734 SNPs β = 0.59, SE = 0.06, P = 2.5×10−24) in UKB with adjustment for age, age2, gender, BMI, and the top 10 PCs, and in ICBP (S1 Table).”

• cites [5] E Evangelou, 2018, Genetic analysis of over 1 million people identifies 535 new loci associated with blood pressure traits, Nat Genet sourceNot checked yet

It may state two separate claims as one.

rs33975708 is a coding variant in CCDC93 (c.535C>T, p.Arg179Cys) with MAF 0.15% in the study population.

“rs33975708 is a coding variant in the CCDC93 gene, c.535C>T, p.Arg179Cys (MAF = 0.15%), and was associated with increased cSBP (β = 29.3 mmHg, P = 1.23x10-7).”

It may state two separate claims as one.

An exome-wide association study in a Han Chinese population identified four SNP-trait associations with three SNPs, including two novel associations (rs2165468-SBP and rs33975708-cSBP).

“We identified four SNP-trait associations with three SNPs, including two novel associations (rs2165468-SBP and rs33975708-cSBP).”

• Also stated in: § PUUMA cohort discovery stage EWAS · plain

  “We identified four locus-trait combinations that reached the Bonferroni corrected genome wide significance threshold of P-value<5.8 × 10−7 in the discovery analysis, including 2 novel SNP-trait associations and 2 previously reported associations (Table 2).”

It may state two separate claims as one.

Human CCDC93 rs33975708 A carriers displayed higher FFA levels (1.67-fold increase, P = 0.35), which was not statistically significant in this underpowered analysis.

“human CCDC93 rs33975708 A carriers displayed higher FFA levels (1.67-fold increase, P = 0.35, S4 Table) that was not statistically significant in this underpowered analysis”

It may state two separate claims as one.

Ccdc93+/- mice demonstrated endothelial dysfunction, evidenced by impaired acetylcholine mediated relaxation, and enhanced arterial contractility.

“Ccdc93+/- mice demonstrated endothelial dysfunction, evidenced by impaired acetylcholine mediated relaxation, as well as enhanced arterial contractility.”

It may state two separate claims as one.

FPUs of Ccdc93+/- heterozygote contained developing embryos that appeared viable and had no evidence of necrosis, inflammation, or hemorrhage.

“FPUs of Ccdc93+/- heterozygote contained developing embryos that appeared viable and had no evidence of necrosis, inflammation, or hemorrhage (S6B Fig).”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Ccdc93+/- heterozygous mice displayed normal aortic histology on H&E and picrosirius red staining and normal peripheral blood counts.

“Ccdc93+/- heterozygous mice displayed normal aortic histology on H&E and picrosirius red staining (S8 Fig) and normal peripheral blood counts (S3 Table).”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Aortic Lrp1 protein expression was higher in Ccdc93+/- mice but did not reach statistical significance (1.17-fold higher, P = 0.083).

“low-density lipoprotein receptor-related protein (Lrp1) protein expression was higher but did not reach statistical significance (1.17-fold higher, P = 0.083”

It may state two separate claims as one.

The study replicated previously reported associations with BP traits and identified 2 novel associations, including the association of cSBP with rs33975708, a nonsynonymous variant in CCDC93 (c.535C>T, p.Arg179Cys).

“We replicated previously reported associations with BP traits, and identified 2 novel associations, including the association of cSBP with rs33975708, a nonsynonymous variant in CCDC93 (c.535C>T, p.Arg179Cys).”

It may state two separate claims as one.

Neither rs2165468-pSBP nor rs13149993-pDBP/pMAP identified any eQTL associations in GTEx v8 or other eQTL databases.

“Neither the specific SNPs nor any proxy SNP, when available, identified any eQTL associations for the additional variants, rs2165468-pSBP and rs13149993-pDBP/pMAP, using the updated GTEx v8 portal and other eQTL databases (such as the Human Genetic Variation Database).”

It may state two separate claims as one.

Ccdc93+/- mice have a 21-nucleotide deletion in a region spanning intron 6/exon 7 and significantly reduced aortic Ccdc93 mRNA transcript and protein expression.

“Ccdc93 heterozygous (Ccdc93+/-) mice have a 21-nucleotide deletion in a region spanning intron 6/exon 7 (2 nucleotides in intron 6 and 19 nucleotides in exon 7, S5 Fig), and significantly reduced aortic Ccdc93 mRNA transcript and protein expression (Fig 2C–2E).”

It may state two separate claims as one.

Meta-analysis of discovery and Ji County data showed consistent directions of effect: β = 24.82, SE = 4.80, P = 2.29x10-7 by inverse-variance-weighted method, and P = 7.03x10-8 by weighted sum of Z-scores.

“Meta-analysis of discovery stage and Ji County data showed consistent directions of effect: β = 24.82, SE = 4.80, P = 2.29x10-7 utilizing inverse-variance-weighted method, and P = 7.03x10-8 by employing a weighted sum of Z-scores method [35].”

• cites [35] CH Lee, 2016, Comparison of Two Meta-Analysis Methods: Inverse-Variance-Weighted Average and Weighted Sum of Z-Scores, Genomics Inform sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Heart weight, kidney weight, and spleen weight normalized over body weight were not significantly different in Ccdc93+/- compared to littermate controls.

“Heart weight, kidney weight and spleen weight normalized over body weight were not significantly different in Ccdc93+/- as compared to littermate controls (S7A–S7C Fig).”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Histological analysis at E10.5 of a single uterine horn revealed 2 resorption sites and 6 healthy FPUs.

“Histological analysis at E10.5 of a single uterine horn revealed 2 resorption sites and 6 healthy FPUs.”

It may state two separate claims as one.

Reduced aortic Ccdc93 transcript expression was observed in Ccdc93+/- mice, consistent with qPCR data.

“with reduced aortic Ccdc93 transcript expression observed as expected in Ccdc93+/- mice, consistent with qPCR data (S10B Fig).”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Total plasma cholesterol was not different between Ccdc93+/- and Ccdc93+/+ mice.

“Total plasma cholesterol was not different between the genotypes.”

It may state two separate claims as one.

In the Ji cohort (N=76), the association of rs33975708 with cSBP was not statistically significant (β = 11.18, SE = 9.64, P = 0.25), but the effect direction was consistent with discovery.

“the association result was not statistically significant, but the effect direction was consistent with the discovery stage result (β = 11.18, SE = 9.64, P = 0.25).”

• cites [34] C Zhan, 2016, Prevalence and Risk Factors of Carotid Plaque Among Middle-aged and Elderly Adults in Rural Tianjin, China., Sci Rep. sourceCheck pending

It may state two separate claims as one.

Phenylephrine-induced contractile responses of Ccdc93+/- aorta were significantly higher starting at 10−6 M (P = 0.048) and maximal PE response at 10−5 M was 123% vs 198% (P = 0.015).

“Phenylephrine (PE)-induced contractile responses of Ccdc93+/- aorta to a high concentration of PE starting at 10−6 M was significantly higher in Ccdc93+/- when compared with Ccdc93+/+ littermate controls (P = 0.048) and remained highly contractile at all increasing PE doses, as compared to Ccdc93+/+ controls (maximal PE response at 10−5 M was 123% vs 198% normalized to maximal response to high KCl”

It may state two separate claims as one.

In Ccdc93+/- heterozygous mice, arterial Ccdc93 transcript expression was reduced approximately 50% and protein expression was reduced by 22%.

“In Ccdc93+/- heterozygous mice, arterial Ccdc93 transcript expression was reduced approximately 50% as expected, while protein expression was reduced by 22%”

It may state two separate claims as one.

Descending thoracic aortic rings of Ccdc93+/- showed impaired acetylcholine-induced relaxation starting at ACh dose 10−7 M (P = 0.043) and remained impaired up to maximal ACh response (86% vs 68%, P = 0.029 at ACh 10−5 M).

“Descending thoracic aortic rings of Ccdc93+/- showed impaired acetylcholine (ACh)-induced relaxation starting at ACh dose 10−7 M (P = 0.043) and relaxation remained impaired for all increasing ACh doses tested up to a maximal ACh response, corresponding to 86% vs 68% (Ccdc93+/+ vs Ccdc93+/-, P = 0.029 at Ach 10−5 M, Fig 2F).”

It may state two separate claims as one.

In an association study of exome-wide variants and BP traits in 5,954 Han Chinese individuals, 4 trait-locus associations with 4 BP traits were identified, including traditionally measured BP traits and cSBP.

“In an association study of exome-wide variants and BP traits in 5,954 Han Chinese individuals, we identified 4 trait-locus associations with 4 BP traits, including traditionally measured BP traits and cSBP”

It may state two separate claims as one.

The association of rs2165468 with pSBP was replicated in 565 participants from Peking University First Hospital (β = 2.45, SE = 1.15, P = 0.034), but not in 127 participants from Third Hospital (β = 1.7, SE = 2.38, P = 0.48).

“This association was replicated in 565 participants from Peking University First Hospital (β = 2.45, SE = 1.15, P = 0.034), but not replicated in 127 participants from third hospital (β = 1.7, SE = 2.38, P = 0.48), although under-powered analyses”

It may state two separate claims as one.

Resorption sites of Ccdc93-/- homozygous FPUs contained hemorrhage and necrotic debris accompanied by neutrophilic and lymphocytic inflammation within and around chorioallantoic membranes on the fetal side, with no embryos or embryonic tissues present.

“Resorption sites of Ccdc93-/- homozygous FPUs contained hemorrhage and necrotic debris accompanied by neutrophilic and lymphocytic inflammation within and around chorioallantoic membranes on the fetal side. There were no embryos or embryonic tissues present (S6C Fig)”

It may state two separate claims as one.

Unbiased transcriptomic analysis demonstrated mitochondrial dysfunction in Ccdc93+/- mice, validated by elevated expression of Parkin and Nix.

“Unbiased transcriptomic analysis demonstrated mitochondrial dysfunction, an effect that was validated in the elevated expression of Parkin and Nix, markers of mitochondrial dysfunction.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Human CCDC93 rs33975708 A carriers showed similar blood glucose levels as non-carriers.

“CCDC93 rs33975708 A carriers showed similar blood glucose levels as compared to non-carriers (S4 Table)”

It may state two separate claims as one.

Total body weight and lean mass were higher in Ccdc93+/- heterozygous mice compared to littermate controls.

“Total body weight, and lean mass measured by echo magnetic resonance imaging (Echo MRI) were higher in Ccdc93+/- heterozygous mice as compared to the littermate controls (S12A Fig).”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Using GRS, the complex genetic architecture of BP regulation in the cohort was aligned with that of previously reported BP GWAS.

“although using GRS, the complex genetic architecture of BP regulation in our cohort was aligned with that of previously reported BP GWAS.”

It may state two separate claims as one.

Endothelium-independent relaxation induced by sodium nitroprusside was impaired in Ccdc93+/- aortic rings at 3.16×10−7 M (P = 0.013), although to an overall milder degree than ACh-induced relaxation.

“Endothelium-independent relaxation induced by sodium nitroprusside was impaired in Ccdc93+/- aortic rings as compared to Ccdc93+/+ control aortic rings at 3.16×10−7 M sodium nitroprusside (P = 0.013, Fig 2G), although to an overall milder degree as compared to ACh-induced arterial relaxation.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

After QC, 5,954 samples and 86,148 SNPs were retained in the BP EWAS.

“Finally, 5,954 samples (2,185 males, 3,768 females) and 86,148 SNPs were retained after the QC in this BP EWAS.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Central systolic blood pressure is heritable with estimated heritability 0.18 in a twin study.

“cSBP is heritable, with estimated heritability 0.18 in a twin study [27];”

• cites [27] H Snieder, 2000, Heritability of central systolic pressure augmentation: a twin study, Hypertension sourceNot checked — no full text of the source

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Conventionally measured systolic and diastolic blood pressure have estimated heritability 0.17-0.52.

“conventionally measured SBP and diastolic BP (DBP) has estimated heritability 0.17–0.52 [28].”

• cites [28] G Kolifarhood, 2019, Heritability of blood pressure traits in diverse populations: a systematic review and meta-analysis, J Hum Hypertens sourceNot checked — no full text of the source

Probably not a substantial claim. It may state two separate claims as one.

Most blood pressure GWAS studies have been conducted in European ancestry samples, and relatively fewer in East Asian samples.

“Furthermore, most BP GWAS studies have been conducted in European ancestry samples, and relatively fewer have been conducted in East Asian samples [31].”

• cites [31] A Giri, 2019, Trans-ethnic association study of blood pressure determinants in over 750,000 individuals, Nat Genet sourceCheck pending

It may state two separate claims as one.

Despite numerous GWAS of peripheral blood pressure, few studies have focused on genetic associations with central blood pressure.

“Despite numerous GWAS of peripheral BP, few studies have focused on genetic associations with central BP [29,30].”

• cites [29] RS Patel, 2012, A genetic risk variant for myocardial infarction on chromosome 6p24 is associated with impaired central hemodynamic indexes, Am J Hypertens sourceCheck pending
• cites [30] M Cecelja, 2020, Genetic aetiology of blood pressure relates to aortic stiffness with bi-directional causality: evidence from heritability, blood pressure polymorphisms, and Mendelian randomization, Eur Heart J sourceCheck pending

Probably not a substantial claim. It may state two separate claims as one.

Central systolic blood pressure responds differently to certain blood-pressure-lowering drugs and may be more closely correlated with future cardiovascular events than peripheral blood pressure measured at the brachial artery.

“cSBP responds differently to certain BP-lowering drugs [17] and cSBP may be more closely correlated with future cardiovascular events as compared to peripheral BP measured at the brachial artery [18,19]”

• cites [17] B Williams, 2006, Differential impact of blood pressure-lowering drugs on central aortic pressure and clinical outcomes: principal results of the Conduit Artery Function Evaluation (CAFE) study., Circulation sourceNot checked — no full text of the source
• cites [18] MJ Roman, 2007, Central pressure more strongly relates to vascular disease and outcome than does brachial pressure: the Strong Heart Study, Hypertension sourceNot checked — no full text of the source
• cites [19] R Pini, 2008, Central but not brachial blood pressure predicts cardiovascular events in an unselected geriatric population: the ICARe Dicomano Study, J Am Coll Cardiol sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

The EWAS used mixed linear models adjusted for age, age2, BMI, and sex, with λGC values ranging from 0.997 to 1.008.

“We conducted an EWAS for each BP trait, using mixed linear models, adjusted for age, age2, BMI, and sex, with resulting λGC values ranging from 0.997 to 1.008.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

The cSBP-associated variant rs33975708 has an overall MAF in the 1000 genomes reference of 4.07%, with the lowest in East Asians (0.00%) and the highest in Europeans (8.55%).

“The cSBP-associated variant, rs33975708, has an overall MAF in the 1000 genomes reference of 4.07% but varies between populations, with the lowest in East Asians (0.00%) and the highest in Europeans (8.55%).”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

In ExAC, the frequency of rs33975708 was 0.2% in individuals of East Asian ancestry and 7.43% in European-ancestry individuals.

“in the Exome Aggregation Consortium (ExAC) database, the frequency of this variant was 0.2% in individuals of East Asian ancestry and 7.43% in European-ancestry individuals.”

It may state two separate claims as one.

Concordant endothelial-dependent and endothelial-independent relaxation impairment in Ccdc93+/- mice, along with increased contractile responses, suggests both endothelial and vascular smooth muscle defects in arterial function resulting from Ccdc93 deficiency.

“Concordant endothelial-dependent and endothelial-independent relaxation impairment in Ccdc93+/- heterozygous mice, along with increased contractile responses to vasoconstrictive challenges, suggested both endothelial and vascular smooth muscle defects in arterial function that result from Ccdc93 deficiency.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Acaa2, Acad9, and Cyp2u1 function in fatty acid beta-oxidation and lipid metabolism, and increased activity is associated with alteration of mitochondrial architecture, bioenergetics and oxidative stress.

“their functions are reported in fatty acid beta-oxidation and lipid metabolism, with increased activity associated with alteration of mitochondrial architecture, bioenergetics and oxidative stress [38–41].”

• cites [38] LF Shen, 2017, Role of S-Palmitoylation by ZDHHC13 in Mitochondrial function and Metabolism in Liver., Sci Rep sourceCheck pending
• cites [39] DN Kwon, 2015, Oxidative stress and ROS metabolism via down-regulation of sirtuin 3 expression in Cmah-null mice affect hearing loss., Aging (Albany NY). sourceCheck pending
• cites [40] C Tesson, 2012, Alteration of fatty-acid-metabolizing enzymes affects mitochondrial form and function in hereditary spastic paraplegia, Am J Hum Genet sourceNot checked — no full text of the source
• cites [41] J Nouws, 2010, Acyl-CoA dehydrogenase 9 is required for the biogenesis of oxidative phosphorylation complex I, Cell Metab sourceNot checked — no full text of the source

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Xdh is a source of superoxide ion, hydrogen peroxide, and nitric oxide, which can function as second messengers in various downstream vascular pathways.

“Xdh is a source of superoxide ion, hydrogen peroxide, and nitric oxide, which can function as second messengers in various downstream vascular pathways [56].”

• cites [56] MG Battelli, 2016, Xanthine Oxidoreductase-Derived Reactive Species: Physiological and Pathological Effects., Oxid Med Cell Longev sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Antihypertensive agents reduced pSBP more than cSBP (WMD 2.52 mmHg, 95% CI 1.35 to 3.69) and β-blockers posed a significantly greater reduction in pSBP compared to cSBP (WMD 5.19 mmHg, 95% CI 3.21 to 7.18).

“a meta-analysis showed antihypertensive agents reduced pSBP more than cSBP (weighted mean difference [WMD] 2.52 mmHg, 95% CI 1.35 to 3.69) and β-Blockers posed a significantly greater reduction in pSBP as compared to cSBP (WMD 5.19 mmHg, 95% CI 3.21 to 7.18) [26].”

• cites [26] TJ McGaughey, 2016, Impact of Antihypertensive Agents on Central Systolic Blood Pressure and Augmentation Index: A Meta-Analysis, Am J Hypertens sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Absence of COMMD9 resulted in reduced Notch-dependent signaling, and deletion of Commd9 led to embryonic lethality in mice due to abnormal cardiovascular development.

“Absence of COMMD9 resulted in reduced Notch-dependent signaling, and deletion of Commd9 led to embryonic lethality in mice due to abnormal cardiovascular development [47].”

• cites [47] H Li, 2015, Endosomal sorting of Notch receptors through COMMD9-dependent pathways modulates Notch signaling, J Cell Biol sourceNot checked yet

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Cyc1 and Aldh5a1, Aldh1a7 are elevated under oxidative stress and function as ROS scavenger and detoxification of highly reactive aldehydes, respectively.

“Cyc1 and Aldh5a1, Aldh1a7 are elevated under oxidative stress and function as ROS scavenger and detoxification of highly reactive aldehydes, respectively [36,37].”

• cites [36] A Atlante, 2000, Cytochrome c is released from mitochondria in a reactive oxygen species (ROS)-dependent fashion and can operate as a ROS scavenger and as a respiratory substrate in cerebellar neurons undergoing excitotoxic death., J Biol Chem sourceCheck pending
• cites [37] S Singh, 2013, Aldehyde dehydrogenases in cellular responses to oxidative/electrophilic stress, Free Radic Biol Med sourceCheck pending

It may state two separate claims as one.

Generation and characterization of a novel transgenic mouse model deficient in Ccdc93 identified a similar phenotype and prioritized vascular mechanisms of BP regulation by Ccdc93 for further study.

“we undertook the generation and characterization of a novel transgenic mouse model deficiency in Ccdc93, which identified a similar phenotype and prioritized vascular mechanisms of BP regulation by Ccdc93 for further study.”

It may state two separate claims as one.

cSBP is associated with future cardiovascular events, and associations independent of pSBP have been defined.

“cSBP is associated with future cardiovascular events, and associations independent of pSBP have been defined [19,23,24,44].”

• cites [19] R Pini, 2008, Central but not brachial blood pressure predicts cardiovascular events in an unselected geriatric population: the ICARe Dicomano Study, J Am Coll Cardiol sourceCheck pending
• cites [23] HM Cheng, 2013, Derivation and validation of diagnostic thresholds for central blood pressure measurements based on long-term cardiovascular risks, J Am Coll Cardiol sourceCheck pending
• cites [24] KL Wang, 2009, Central or peripheral systolic or pulse pressure: which best relates to target organs and future mortality?, J Hypertens sourceCheck pending
• cites [44] Y Dong, 2020, Central rather than brachial pressures are stronger predictors of cardiovascular outcomes: a longitudinal prospective study in a Chinese population., J Clin Hypertens (Greenwich). sourceCheck pending

It may state two separate claims as one.

All 92 proxy eSNPs showed the same effect as rs33975708 and CCDC93, with the minor allele linked to reduced CCDC93 expression.

“All 92 proxy eSNPs showed the same effect as rs33975708 and CCDC93, with the minor allele linked to reduced CCDC93 expression, indirectly supporting our study’s signals.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Mdh2 is the final enzyme in the mitochondrial tricarboxylic acid cycle and its activity is associated with increased oxidative stress in the brain of Alzheimer disease.

“Mdh2 is the final enzyme in the mitochondrial tricarboxylic acid cycle and its activity is associated with increased oxidative stress in the brain of Alzheimer disease [55].”

• cites [55] P Bubber, 2005, Mitochondrial abnormalities in Alzheimer brain: mechanistic implications, Ann Neurol sourceNot checked — no full text of the source

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Recycling to the cell surface of Notch is dependent on the CCC complex.

“The recycling to the cell surface of Notch is dependent on the CCC complex [46,47].”

• cites [46] R. Kopan, 2012, Notch signaling, Cold Spring Harb Perspect Biol sourceCheck pending
• cites [47] H Li, 2015, Endosomal sorting of Notch receptors through COMMD9-dependent pathways modulates Notch signaling, J Cell Biol sourceNot checked yet

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

In a previous genetic study of individuals of European ancestry, CCDC93 rs17512204 was associated with lower LDL-C levels, lower cardiovascular mortality, and lower risk of myocardial infarction.

“In a previous genetic study of individuals of European ancestry, CCDC93 (rs17512204; C>T, p.Pro228Leu) was associated with lower LDL-C levels, lower cardiovascular mortality, and lower risk of myocardial infarction [43].”

• cites [43] A Rimbert, 2020, A common variant in CCDC93 protects against myocardial infarction and cardiovascular mortality by regulating endosomal trafficking of low-density lipoprotein receptor, Eur Heart J sourceNot checked yet

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Both CCDC93 and the CCC complex mediate endosomal sorting of the low-density lipoprotein receptor (LDLR).

“Both CCDC93 and the CCC complex mediate endosomal sorting of the low-density lipoprotein receptor (LDLR) [43,48,49].”

• cites [43] A Rimbert, 2020, A common variant in CCDC93 protects against myocardial infarction and cardiovascular mortality by regulating endosomal trafficking of low-density lipoprotein receptor, Eur Heart J sourceNot checked yet
• cites [48] A Fedoseienko, 2018, The COMMD Family Regulates Plasma LDL Levels and Attenuates Atherosclerosis Through Stabilizing the CCC Complex in Endosomal LDLR Trafficking, Circ Res sourceNot checked yet
• cites [49] P Bartuzi, 2016, CCC- and WASH-mediated endosomal sorting of LDLR is required for normal clearance of circulating LDL., Nat Commun sourceNot checked yet

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Additional CCDC93 variants have been associated with venous thromboembolism, triglyceride levels, and total cholesterol levels.

“Additional CCDC93 variants have been associated with venous thromboembolism, triglyceride levels, and total cholesterol levels [50–52].”

• cites [50] N Sinnott-Armstrong, 2021, Genetics of 35 blood and urine biomarkers in the UK Biobank, Nat Genet sourceNot checked yet
• cites [51] H Deguchi, 2020, Novel exomic rare variants associated with venous thrombosis, Br J Haematol sourceCheck pending
• cites [52] D Klarin, 2018, Genetics of blood lipids among ~300,000 multi-ethnic participants of the Million Veteran Program, Nat Genet sourceNot checked yet

It may state two separate claims as one.

Ccdc93-/- embryos either did not develop or died very early in gestation.

“suggesting that Ccdc93-/- embryos either did not develop or died very early in gestation.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

CCDC93 gene encodes a protein that is part of the CCC protein complex comprised of COMMD, CCDC22, and CCDC93.

“The coiled-coil domain containing 93 (CCDC93) gene encodes for a protein that is part of the “CCC” protein complex comprised of COMMD, CCDC22, and CCDC93.”

It may state two separate claims as one.

Using GTEx v8, 275 eSNPs for CCDC93 in aorta and 270 eSNPs in tibial artery were identified; 92 eSNPs were in LD with rs33975708 (R2>0.2, +/-500Kb).

“Using GTEx v8 data, we identified 275 expression-associated SNPs (eSNPs) for CCDC93 in the aorta and 270 eSNPs in the tibial artery. Of these, 92 eSNPs were in linkage disequilibrium (LD) with rs33975708 (R2>0.2, +/- 500Kb) as per 1000G CEU population.”

Probably not a substantial claim.

SBP measurement in mice was performed by non-invasive tail-cuff plethysmography as previously described.

“Male and female Ccdc93+/- (129/Sv) mice and their littermate controls at 12–16 weeks of age underwent SBP measurement by non-invasive tail-cuff plethysmography (BP-2000, Visitech Systems, NC) as previously described [74].”

• cites [74] N Kumar, 2018, Thymosin beta4 Deficiency Exacerbates Renal and Cardiac Injury in Angiotensin-II-Induced Hypertension, Hypertension sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Nix plays a critical role in Parkin-mediated mitochondrial autophagy by controlling the mitochondrial translocation of Parkin.

“Nix also plays a critical role in Parkin-mediated mitochondrial autophagy by controlling the mitochondrial translocation of Parkin [69].”

• cites [69] WX Ding, 2010, Nix is critical to two distinct phases of mitophagy, reactive oxygen species-mediated autophagy induction and Parkin-ubiquitin-p62-mediated mitochondrial priming, J Biol Chem sourceCheck pending

Probably not a substantial claim.

Two novel identified SNPs with P < 5.8 × 10−7 (0.05/86,148) were re-examined in the replication stage.

“two novel identified SNPs with P <5.8 × 10−7 (0.05/86,148) were re-examined in replication stage.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Elevated plasma FFA levels have been positively associated with SBP in nondiabetic subjects in a cross-sectional study.

“elevated plasma FFA levels have been positively associated with SBP in nondiabetic subjects in a cross-sectional study [62].”

• cites [62] M Carlsson, 2000, High levels of nonesterified fatty acids are associated with increased familial risk of cardiovascular disease, Arterioscler Thromb Vasc Biol sourceNot checked — no full text of the source

Probably not a substantial claim.

Associations of novel BP-related SNPs with coronary artery disease risk factors were tested using multivariate linear regression with models adjusting for sex and age.

“Associations of novel BP-related SNPs with risk factors of coronary artery disease (including blood lipids, BP traits, pulse wave velocity, and body mass index) were tested using multivariate linear regression, with models adjusting for sex and age, using R program.”

Probably not a substantial claim.

P < 0.05 was defined as statistically significant.

“P<0.05 was defined to be statistically significant.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

The promoters of medium-chain acyl-CoA dehydrogenase and mitochondrial HMG-CoA synthase are Ppar-α responsive.

“The promoters of medium-chain acyl-CoA dehydrogenase and mitochondrial HMG-CoA synthase are Ppar-α responsive [60].”

• cites [60] B. Grygiel-Gorniak, 2014, Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications—a review, Nutr J sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it.

PPAR agonists are involved in the production of reactive oxygen species.

“PPAR agonists are also involved in the production of reactive oxygen species [61].”

• cites [61] E Teissier, 2004, Peroxisome proliferator-activated receptor alpha induces NADPH oxidase activity in macrophages, leading to the generation of LDL with PPAR-alpha activation properties, Circ Res sourceNot checked — no full text of the source

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Ppar-α has been implicated in the regulation of genes involved in mitochondrial fatty acid β-oxidation.

“Ppar-α has been implicated in the regulation of genes involved in mitochondrial fatty acid β-oxidation.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

All animal procedures were approved by University of Michigan IACUC, and mice were housed and cared for in accordance with the Guide for the Care and Use of Laboratory Animals.

“All animal procedures were approved by University of Michigan Institutional Animal Care and Use Committee (IACUC), and mice were housed and cared for in accordance with the Guide for the Care and Use of Laboratory Animals.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Alterations in mitochondrial function and ROS production have been associated with endothelial dysfunction, development of hypertension, and cardiac hypertrophy.

“Evidence suggests that alterations in mitochondrial function and ROS production have been associated with endothelial dysfunction, development of hypertension, and cardiac hypertrophy [70].”

• cites [70] V Lahera, 2017, Role of Mitochondrial Dysfunction in Hypertension and Obesity., Curr Hypertens Rep sourceNot checked — no full text of the source

Probably not a substantial claim. The paper’s conclusions may not depend on it.

The housekeeping gene product Gapdh served as a loading control.

“The housekeeping gene product Gapdh (1:10,000, # 97166, CST) served as a loading control.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

The correlation r2 of allele frequencies between PUUMA Chinese samples and 1000 Genomes East Asian samples was 0.98.

“The correlation r2 of the allele frequencies between PUUMA Chinese samples and 1000 Genomes East Asian samples was 0.98.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

The discovery stage tested 5,954 samples and 86,148 SNPs.

“5,954 samples and 86,148 SNPs were tested in the discovery stage”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Photo processing was confined to global adjustment of image size, white balance, brightness, or contrast that did not materially alter the interpretation of the image.

“Photo processing was confined to global adjustment of image size, white balance, brightness, or contrast that did not materially alter the interpretation of the image.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Study protocols were approved by the IRB of Peking University First Hospital and Peking University Health Science center, and by the University of Michigan IRB; written informed consent was collected from all subjects.

“Study protocols were approved by the Institutional Review Board (IRB) of Peking University First Hospital (IRB2014[816]) and Peking University Health Science center (IRB00001052-11086), and the study was approved by the University of Michigan IRB (HUM00074756). Written informed consent was collected from all subjects.”

Probably not a substantial claim.

Vascular reactivity was assessed by wire myography as previously described.

“Vascular reactivity assessed by wire myography was performed as previously described [83].”

• cites [83] MD Stevenson, 2023, Reactivity of renal and mesenteric resistance vessels to angiotensin II is mediated by NOXA1/NOX1 and superoxide signaling, Am J Physiol Renal Physiol sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

RNA-Seq analysis used DESeq2 and a significant threshold of FDR < 0.1.

“The significant threshold was defined as false discovery rate (FDR) < 0.1.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Ccdc93+/- mice were mated with C57BL/6 and 129/Sv mice for at least 10 generations to confirm germline transmission.

“Ccdc93+/- mice were mated with C57BL/6 mice and 129/Sv mice (Taconic Biosciences, NY, USA) for at least 10 generation to confirm germline transmission.”

Probably not a substantial claim.

Variants that achieved a P-value less than 5×10−8 from GWAS of the same trait were selected and LD-pruned (R2 > 0.2 in a 500 Kb window).

“Variants that achieved a P-value less than 5×10−8 from GWAS of the same trait were selected and LD-pruned (R2>0.2 in a 500Kb window).”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Genotyping of Ccdc93+/- mice was performed by PCR and confirmed by Sanger sequencing.

“Genotyping of Ccdc93+/- mice was performed by PCR amplifying the region using forward (5’GGAAGGGTGGGAGCGAGGAG3’) and reverse primer (5’ GTTGGCTTGCTTGCTTCTTTCTTTC 3’) and confirmed by sanger sequencing (Genewiz, NJ), S5 Fig.”

Probably not a substantial claim. It may state two separate claims as one.

Genotyping QC excluded variants with low cluster score, Hardy-Weinberg equilibrium deviations P < 0.0001 and call rate < 99%; variants with a minor allele count larger than 3 were included.

“Variants with low cluster score, Hardy-Weinberg equilibrium deviations P < 0.0001 and call rate < 99% were excluded. Variants with a minor allele count larger than 3 were included.”

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

Nix is a mitochondrial protein and a member of the Bcl-2 family of apoptotic regulators and is implicated in the pathogenesis of cancer and heart disease by regulating mitophagy and cell death.

“Nix is a mitochondrial protein and a member of the Bcl-2 family of apoptotic regulators and is implicated in the pathogenesis of cancer and heart disease by regulating mitophagy and cell death [68].”

• cites [68] J Zhang, 2009, Role of BNIP3 and NIX in cell death, autophagy, and mitophagy, Cell Death Differ sourceNot checked yet

Probably not a substantial claim. The paper’s conclusions may not depend on it.

EC-TRAP was performed as previously described.

“EC-TRAP was performed as we have previously described [75].”

• cites [75] ACA Cleuren, 2019, The in vivo endothelial cell translatome is highly heterogeneous across vascular beds, Proc Natl Acad Sci U S A sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it.

λGC was evaluated for evidence of population stratification.

“λGC was evaluated for evidence of population stratification.”

Probably not a substantial claim.

Noninvasive cSBP measurements were performed using radial artery tonometry with an Omron HEM-9000AI device, as described and validated previously.

“Noninvasive cSBP measurements were performed in a seated position using radial artery tonometry with an Omron HEM-9000AI device, as we have described and validated previously [22].”

• cites [22] F Fan, 2016, Noninvasive Central Systolic Blood Pressure Is More Strongly Related to Kidney Function Decline Than Peripheral Systolic Blood Pressure in a Chinese Community-Based Population, Hypertension sourceCheck pending

Probably not a substantial claim.

A published BP GWAS including more than one million people was used to construct a BP weighted genetic risk score, with SNPs weighted by BP coefficients from that GWAS's discovery results.

“A published BP GWAS finding that included more than one million people was used to construct BP weighted genetic risk score (GRS), where SNPs were weighted according to BP coefficients from the GWAS discovery results(5).”

• cites [5] E Evangelou, 2018, Genetic analysis of over 1 million people identifies 535 new loci associated with blood pressure traits, Nat Genet sourceNot checked yet

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Slides were evaluated by a board-certified veterinary pathologist.

“Slides were evaluated by a board-certified veterinary pathologist using a BX45 Olympus light microscope.”

Probably not a substantial claim. It may state two separate claims as one.

Sample QC excluded duplicates based on IBD analysis, gender mismatched samples, and samples with missing phenotypes; all samples had missing call rate < 1%; none failed inbreeding coefficient check.

“we excluded duplicates based on whole genome genotyping data IBD (Identical by descent) analysis, gender miss-matched samples, and samples with missing phenotypes. All samples had missing call rate < 1%. None of them failed QC in inbreeding coefficient check.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

The GTX package in R was applied to test the association between PRS of known BP and the study's BP analysis using GWAS summary statistics adjusted for age, age2, sex, BMI, and principal components.

“The GTX package (https://www.rdocumentation.org/packages/gtx/versions/0.0.8) in R was applied to test the association between PRS of known BP and our BP analysis using GWAS summary statistics adjusted for age, age2, sex, BMI, and principal components (PCs).”

It may state two separate claims as one.

Experimental FFA elevation by intralipid infusion in non-obese women resulted in impaired capillary recruitment and acetylcholine-induced vasodilation in the skin microvasculature, as well as increased SBP.

“Experimental FFA elevation achieved by intralipid infusion in non-obese women resulted in impaired capillary recruitment and acetylcholine-induced vasodilation in the skin microvasculature, as well as increased SBP [63].”

• cites [63] RT de Jongh, 2004, Free fatty acid levels modulate microvascular function: relevance for obesity-associated insulin resistance, hypertension, and microangiopathy., Diabetes sourceCheck pending

Probably not a substantial claim. The paper’s conclusions may not depend on it. It may state two separate claims as one.

For mouse experiments, all data were reported as mean±s.d. and Student's t tests (unpaired, two-tailed) were used to compare significance between the two groups.

“For experiments involving mice, all data were reported as mean±s.d. Student’s t tests (unpaired, two-tailed) were used to compare the significance between the two groups.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

For the analyses of blood lipids, individuals taking lipid-lowering drugs were excluded.

“For the analyses of blood lipids, those who were taking lipid-lowering drugs were excluded.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Manhattan plots were generated from exome-wide SNPs, with known BP GWAS ± 500 Kb regions marked as positive controls and to filter newly discovered loci.

“Manhattan plots were generated from exome-wide SNPs, with marked of known BP GWAS ± 500 Kb region as positive controls and to filter the newly discovered loci.”

Probably not a substantial claim.

Phenotypes were adjusted for age, age2, BMI, and sex before running the mixed linear model on residuals and exome-wide SNPs.

“As described above, we adjusted for age, age2, BMI, and sex for our phenotypes first and run mixed linear model based on the residuals and the exome-wide SNPs.”

Probably not a substantial claim. The paper’s conclusions may not depend on it.

Quantile-quantile plots were depicted for SNPs in different minor allele frequency groups.

“Quantile-quantile plots were depicted for SNPs in different minor allele frequency groups.”