Wnt and TGF-β Expression in the Sponge Amphimedon queenslandica and the Origin of Metazoan Embryonic Patterning
Open accessAbstract
BACKGROUND: The origin of metazoan development and differentiation was contingent upon the evolution of cell adhesion, communication and cooperation mechanisms. While components of many of the major cell signalling pathways have been identified in a range of sponges (phylum Porifera), their roles in development have not been investigated and remain largely unknown. Here, we take the first steps toward reconstructing the developmental signalling systems used in the last common ancestor to living sponges and eumetazoans by studying the expression of genes encoding Wnt and TGF-beta signalling ligands during the embryonic development of a sponge. METHODOLOGY/PRINCIPAL FINDINGS: Using resources generated in the recent sponge Amphimedon queenslandica (Demospongiae) genome project, we have recovered genes encoding Wnt and TGF-beta signalling ligands that are critical in patterning metazoan embryos. Both genes are expressed from the earliest stages of Amphimedon embryonic development in highly dynamic patterns. At the time when the Amphimedon embryos begin to display anterior-posterior polarity, Wnt expression becomes localised to the posterior pole and this expression continues until the swimming larva stage. In contrast, TGF-beta expression is highest at the anterior pole. As in complex animals, sponge Wnt and TGF-beta expression patterns intersect later in development during the patterning of a sub-community of cells that form a simple tissue-like structure, the pigment ring. Throughout development, Wnt and TGF-beta are expressed radially along the anterior-posterior axis. CONCLUSIONS/SIGNIFICANCE: We infer from the expression of Wnt and TGF-beta in Amphimedon that the ancestor that gave rise to sponges, cnidarians and bilaterians had already evolved the capacity to direct the formation of relatively sophisticated body plans, with axes and tissues. The radially symmetrical expression patterns of Wnt and TGF-beta along the anterior-posterior axis of sponge embryos and larvae suggest that these signalling pathways contributed to establishing axial polarity in the very first metazoans.
AI snapshot
Written from the paper’s full text.
TL;DR
The paper identifies Wnt and TGF-β ligand genes in the sponge *Amphimedon queenslandica* and shows they are expressed in dynamic, localized patterns during embryogenesis, with Wnt localizing to the posterior pole and TGF-β highest at the anterior pole. It infers that these pathways contributed to axial polarity and tissue patterning in the last common ancestor of living metazoans.
Key findings
- One Wnt and one TGF-β gene were recovered from *Amphimedon*; the Wnt protein contains a signal peptide and 24 conserved cysteines, while the TGF-β signalling domain is close to the GDNF subfamily, retains 6 of 7 conserved cysteines (missing cysteine 4), and has a signal peptide plus conserved RTRRS cleavage site.
- Wnt is expressed from early cleavage in small micromeres, becomes enriched interiorly at blastula, restricts to the inner cell mass on one side before morphological asymmetry, then localizes to the outer layer at the posterior pole during gastrulation; it overlaps the pigment spot/ring and continues in the posterior pole of swimming larvae.
- TGF-β is first detected in micromeres, becomes more prominent in the outer region at blastula, and during gastrulation is restricted to the outer layer with stronger anterior and posterior domains; at the pigment spot stage it is strong at the anterior pole, weak in the spot centre, and absent just outside the spot, then during ring formation it marks the inner rim and fades by late ring stages, with no transcripts detected in swimming larvae.
- Wnt and TGF-β expression intersect at the posterior pole during pigment ring formation, and both are expressed radially along the anterior-posterior axis, suggesting combinatorial roles in axial polarity and patterning of a simple tissue-like structure.
Methods
- Wnt and TGF-β cDNAs were isolated using EST and genome trace searches plus 5′ RACE from embryonic RNA, with RT-PCR confirmation for Wnt; phylogenetic analyses were used to assign orthology.
- Whole mount in situ hybridization was performed on *Amphimedon* embryos and larvae using complete coding sequences cloned into pGEMT; samples were photographed whole mount, then dehydrated, infiltrated with Epon 812 resin, sectioned at 5 µm, and mounted.
- Embryonic stages were characterized from brood chambers, including cleavage, solid blastula, gastrulation, pigment spot, pigment ring, and swimming larva stages.
Limitations
- The paper states that it cannot discern whether the initial localized Wnt expression occurs in the same cells that express Wnt later, because of a lack of cell lineage data.
- The paper states that phylogenetic analyses cannot confidently assign the sponge Wnt into a recognized eumetazoan sub-family, and that there is limited evidence for homology between the posterior poles of *Amphimedon* and *Nematostella*.
- Evident from the text: conclusions about ancestral roles are inferential from expression patterns in a single sponge species, and no functional perturbation or direct test of Wnt–TGF-β interaction is reported.
Model-written summary. Check it against the paper before relying on it.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
0 of 27 cited sources checked · 0 supported · 0 flagged
- Findingown data
As gastrulation progresses and separation of outer and inner layer becomes apparent, Wnt-expressing cells become confined to the outer layer at the posterior pole.
“As gastrulation progresses and separation of outer and inner layer becomes apparent, the Wnt-expressing cells become confined to the outer layer at the posterior pole (Fig 2E, F).”
Quote in the paperSubstantial claim - Findingown data
At the blastula stage, Wnt-expressing cells are enriched in the inner part of the embryo.
“At this stage, Wnt-expressing cells are enriched in the inner part of the embryo (Fig 2B).”
Quote in the paperSubstantial claim - Findingown data
During ring formation stages, TGF-β expression continues throughout the outer layer except the narrow band of cells just outside of the ring.
“During the ring formation stages, TGF-β expression continues throughout the outer layer except of the narrow band of cells just outside of the ring (Fig. 3I, J).”
Quote in the paperNot a substantial claim - Findingown data
Phylogenetic analysis of the predicted Amphimedon TGF-β signalling domain places it close to the GDNF subfamily of TGF-β molecules.
“Phylogenetic analysis of the predicted Amphimedon TGF-β signalling domain places it close to the GDNF subfamily of TGF-β molecules (Fig. S3).”
Quote in the paperNot a substantial claim - Findingown data
The Wnt expression domain overlaps with the pigment spot and ring.
“The Wnt expression domain overlaps with the pigment spot and ring (Fig. 2G–I)”
Quote in the paperSubstantial claim
- Findingown data
At the time when Amphimedon embryos begin to display anterior-posterior polarity, Wnt expression becomes localised to the posterior pole and continues until the swimming larva stage.
“At the time when the Amphimedon embryos begin to display anterior-posterior polarity, Wnt expression becomes localised to the posterior pole and this expression continues until the swimming larva stage.”
Quote in the paperSubstantial claim - Findingown data
During cleavage, Wnt transcripts first can be detected in very small micromeres uniformly distributed throughout the embryo and interspersed between the macromeres.
“Wnt transcripts first can be detected in very small micromeres that are uniformly distributed throughout the embryo and interspersed between the macromeres (Fig. 2A).”
Quote in the paperSubstantial claim - Findingown data
TGF-β expression is highest at the anterior pole.
“In contrast, TGF-β expression is highest at the anterior pole.”
Quote in the paperSubstantial claim - Findingcitation
Phylogenetic analyses cannot confidently assign the Amphimedon Wnt into a recognised eumetazoan sub-family.
“although phylogenetic analyses can not confidently assign this sponge Wnt into a recognised eumetazoan sub-family (Fig. S2) [39].”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites [39] 2007
Not checked in the free run.
- Findingown data
As pigment ring formation progresses, TGF-β expression is no longer detected in the centre of the ring, but delineates the inner rim of the ring.
“As pigment ring formation progresses, TGF-β expression is not longer detected in the centre of the ring, but delineates the inner rim of the ring (Fig. 3I, J).”
Quote in the paperSubstantial claim - Findingown data
As the pigment cells begin to move concentrically away from the posterior pole to form the pigment ring, TGF-β is expressed inside of the ring.
“As the pigment cells begin to move concentrically away from the posterior pole to form the pigment ring [Fig. 1K], [21, 22], TGF-β is expressed inside of the ring (Fig. 3H).”
Quote in the paperNot a substantial claim0 of 2 sources checked- cites [21] SP Leys, 2002, Embryogenesis and metamorphosis in a haplosclerid demosponge: Gastrulation and transdifferentiation of larval ciliated cells to choanocytes., Invertebr Biol source
Not checked in the free run.
- cites [22] BM Degnan, 2005, Sponge development and antiquity of animal pattern formation., Integr Comp Biol source
Not checked in the free run.
- Findingown data
Wnt expression continues within the pigment ring in the free swimming larva.
“this expression continues within the pigment ring in the free swimming larva (Fig. 2J).”
Quote in the paperNot a substantial claim - Findingown data
The anterior pole domain of TGF-β expression is particularly prominent at the spot stage.
“The anterior pole domain of TGF-β expression is particularly prominent at the spot stage (Fig 3F, G).”
Quote in the paperNot a substantial claim - Findingown data
Amphimedon Wnt gene is expressed from the early stages of development.
“Amphimedon Wnt gene is expressed from the early stages of development (Fig. 2).”
Quote in the paperSubstantial claim - Findingown data
At the pigment spot stage, TGF-β expression is maintained in the centre of the spot and throughout the outer layer, except in pigment cells making the outer portion of the spot and the region immediately adjacent to the spot.
“At the pigment spot stage (Fig. 1J, 3E–F), TGF-β expression is maintained in the centre of the spot and throughout the outer layer, except in pigment cells making the outer portion of the spot and the region immediately adjacent to the spot (Fig. 3E, F).”
Quote in the paperNot a substantial claim - Findingown data
Throughout development, Wnt and TGF-β are expressed radially along the anterior-posterior axis.
“Throughout development, Wnt and TGF-β are expressed radially along the anterior-posterior axis.”
Quote in the paperSubstantial claim - Findingown data
At the gastrula stage, the posterior domain of TGF-β expression overlaps with Wnt expression at the posterior pole.
“Thus, at the gastrula stage, the posterior domain of TGF-β-expression overlaps with Wnt-expression at the posterior pole.”
Quote in the paperSubstantial claim - Findingcitation
Before any morphological asymmetry can be detected, Wnt-expressing cells become restricted to the inner cell mass on one side of the embryo.
“Before any morphological asymmetry in the embryo can be detected by cytological indicators [21], [22, unpublished], Wnt-expressing cells become restricted to the inner cell mass on one side of the embryo (Fig. 2C, D).”
Quote in the paperSubstantial claim0 of 2 sources checked- cites [21] SP Leys, 2002, Embryogenesis and metamorphosis in a haplosclerid demosponge: Gastrulation and transdifferentiation of larval ciliated cells to choanocytes., Invertebr Biol source
Not checked in the free run.
- cites [22, unpublished]
Not checked in the free run.
- Findingown data
There is no evidence that Wnt transcripts are maternally deposited in oocytes or eggs.
“There is no evidence that Wnt transcripts are maternally deposited in oocytes or eggs.”
Quote in the paperSubstantial claim - Findingown data
A zone of intersecting Wnt and TGF-β expression occurs anterior of the leading edge of the concentric front of migrating pigment cells.
“A zone of intersecting Wnt and TGF-β expression occurs anterior of the leading edge of the concentric front of migrating pigment cells (compare Fig. 2I and 3 H–J)”
Quote in the paperSubstantial claim - Interpretationown data
Sponge Wnt and TGF-β expression patterns intersect later in development during the patterning of a sub-community of cells that form the pigment ring.
“As in complex animals, sponge Wnt and TGF-β expression patterns intersect later in development during the patterning of a sub-community of cells that form a simple tissue-like structure, the pigment ring.”
Quote in the paperSubstantial claim - Interpretationreasoning
The blastula-stage TGF-β and Wnt expression patterns indicate that these are largely different populations of cells.
“indicating that these are largely different populations of cells.”
Quote in the paperSubstantial claim - Premisecitation
In both Amphimedon and the cnidarian Nematostella, Wnt expression is restricted to the posterior ends of the larva.
“In both Amphimedon and the cnidarian Nematostella, Wnt expression is restricted to the posterior ends of the larva [3], [5], although mechanisms of gastrulation are different and there is limited evidence for these poles being homologous.”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [3], [5]
Not checked in the free run.
- Interpretationreasoning
The radially symmetrical expression patterns of Wnt and TGF-β along the anterior-posterior axis of sponge embryos and larvae suggest that these signalling pathways contributed to establishing axial polarity in the very first metazoans.
“The radially symmetrical expression patterns of Wnt and TGF-β along the anterior-posterior axis of sponge embryos and larvae suggest that these signalling pathways contributed to establishing axial polarity in the very first metazoans.”
Quote in the paperSubstantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Rests on an assumption: The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
- Interpretationreasoning
The movements of pigment cells and sclerocytes are consistent with a role for these metazoan-specific ligands interacting to establish axial polarity in sponge embryos in a manner akin to that observed in other metazoans.
“The movements of pigment cells and sclerocytes are consistent with a role for these metazoan-specific ligands interacting to establish axial polarity in sponge embryos in a manner akin to that observed in other metazoans [1], [30], [45], [46].”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [1], [30], [45], [46]
Not checked in the free run.
- Rests on an assumption: The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
- Premisecitation
The origination of Hox genes and expansion of a range of developmental transcription factor gene families enabled further elaboration of ancestral gene regulatory networks.
“Along with the diversification signalling pathways in eumetazoans was the origination of Hox genes [24] and expansion of a range of developmental transcription factor gene families [23], [28, unpublished], which enabled further elaboration of ancestral gene regulatory networks.”
Quote in the paperNot a substantial claim0 of 3 sources checked- cites [24] C Larroux, 2007, The NK homeobox gene cluster predates the origin of Hox genes., Curr Biol source
Not checked in the free run.
- cites [23] C Larroux, 2006, Developmental expression of transcription factor genes in a demosponge: insights into the origin of metazoan multicellularity., Evol Dev source
Not checked in the free run.
- cites [28, unpublished]
Not checked in the free run.
- Interpretationown data
Sponge embryos are patterned by signalling mechanisms strikingly similar to those controlling cell specification and patterning in bilaterians and cnidarians.
“Our results suggest that sponge embryos are patterned by signalling mechanisms strikingly similar to those controlling cell specification and patterning in bilaterians and cnidarians.”
Quote in the paperSubstantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Interpretationreasoning
The early expression of Wnt and TGF-β in Amphimedon embryos is compatible with a role in establishing axial polarity.
“The early expression of Wnt and TGF-β in Amphimedon embryos is compatible with a role in establishing axial polarity.”
Quote in the paperSubstantial claim- Rests on an assumption: The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
- Interpretationreasoning
The differential expansion and elaboration of this network in the eumetazoan lineage, compared to the sponge lineage, provided the foundation for the extensive body plan diversification seen in this clade, including possibly the origin of a second body axis.
“The differential expansion and elaboration of this network in the eumetazoan lineage, compared to the sponge lineage, provided the foundation for the extensive body plan diversification seen in this clade, including possibly the origin of a second body axis.”
Quote in the paperSubstantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Interpretationcitation
The zone of intersecting Wnt and TGF-β expression may be providing positional information in a manner similar to that observed during the formation of limbs in Drosophila and the head organizer in cnidarians.
“and may be providing positional information [47] in manner similar to that observed during the formation of limbs in Drosophila [34] and the head organizer in cnidarians [48].”
Quote in the paperNot a substantial claim0 of 3 sources checked- cites [47] L Wolpert, 1996, One hundred years of positional information., Trends Genet source
Not checked in the free run.
- cites [34] B Cohen, 1993, Allocation of the thoracic imaginal primordia in the <italic>Drosophila</italic> embryo., Development source
Not checked in the free run.
- cites [48] M Broun, 2005, Formation of the head organizer in hydra involves the canonical Wnt pathway., Development source
Not checked in the free run.
- Study design and conductown data
The authors cannot discern if the initial localized expression of Wnt is in the same cells that express Wnt later in development because of a lack of cell lineage data.
“We can not discern if the initial localized expression of Wnt is in the same cells that express Wnt later in development because of a lack of cell lineage data.”
Quote in the paperNot a substantial claim - Interpretationreasoning
The evolution of this canonical zootypic network may have been the necessary precursor for the diversification of all contemporary metazoan body plans.
“The evolution of this canonical zootypic network may have been the necessary precursor for the diversification of all contemporary metazoan body plans.”
Quote in the paperNot a substantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Interpretationreasoning
The migration of pigment cells towards Wnt-expressing cells at the posterior pole is indicative of the existence of differential signals along the AP axis.
“The migration of pigment cells towards Wnt-expressing cells at the posterior pole is indicative of the existence of differential signals along the AP axis”
Quote in the paperSubstantial claim- Rests on an assumption: The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
- Interpretationown data
The ancestor that gave rise to sponges, cnidarians and bilaterians had already evolved the capacity to direct the formation of relatively sophisticated body plans, with axes and tissues.
“We infer from the expression of Wnt and TGF-β in Amphimedon that the ancestor that gave rise to sponges, cnidarians and bilaterians had already evolved the capacity to direct the formation of relatively sophisticated body plans, with axes and tissues.”
Quote in the paperSubstantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Rests on an assumption: The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
- The authors state this as an assumption: The last common ancestor to all living metazoans can be reconstructed by identifying common features in embryonic development of distantly related extant clades.
- Interpretationreasoning
The migration of pigment cells towards Wnt-expressing cells at the posterior pole is compatible with Wnt and/or TGF-β contributing to the establishment of this axis.
“and is compatible with Wnt and/or TGF-β contributing to the establishment of this axis.”
Quote in the paperSubstantial claim- Rests on an assumption: The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
- Premisecitation
Other studies on sponges have detected components of Wnt and TGF-β signalling pathways in sponges.
“While other studies on sponges have detected components of Wnt and TGF-β signalling pathways in sponges [37], [42]–[44], this is the first to show that these pathways are expressed during sponge embryogenesis.”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [37], [42]–[44]
Not checked in the free run.
- Interpretationreasoning
Wnt and TGF-β signalling pathways appear to have acted combinatorially to specify and pattern cells in the last common ancestor to all extant metazoans.
“Wnt and TGF-β signalling pathways appear to have acted combinatorially to specify and pattern cells in the last common ancestor to all extant metazoans (Fig. 4).”
Quote in the paperSubstantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Premisecitation
A hedgehog-like cell surface signal Hedgling is expressed in overlapping patterns with Wnt and TGF-β during ring formation.
“In addition, a hedgehog-like cell surface signal–Hedgling–is expressed in overlapping patterns with Wnt and TGF-β during ring formation [25].”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [25] M Adamska, 2007, The evolutionary origin of hedgehog proteins., Curr Biol
Not checked in the free run.
- Premisecitation
TGF-β ligands involved in determination of the dorsal-ventral axis in bilaterians are also asymmetrically expressed during cnidarian development.
“Even more surprisingly, TGF-β ligands that are involved in determination of the dorsal-ventral axis in bilaterians are also asymmetrically expressed during cnidarian development [6], [7], [10].”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [6], [7], [10]
Not checked in the free run.
- Interpretationreasoning
The developmental expression of these signalling systems, along with that of many metazoan-specific transcription factor families, indicates that the last common ancestor to all living metazoans already possessed the regulatory capacity to form complex body plans.
“The developmental expression of these signalling systems, along with that of many metazoan-specific transcription factor families [23], indicates that the last common ancestor to all living metazoans already possessed the regulatory capacity to form complex body plans, using the same molecular components as animals living over 550 million years later [49].”
Quote in the paperSubstantial claim0 of 2 sources checked- cites [23] C Larroux, 2006, Developmental expression of transcription factor genes in a demosponge: insights into the origin of metazoan multicellularity., Evol Dev source
Not checked in the free run.
- cites [49] EH Davidson, 2006, The Regulatory Genome: Gene Regulatory Networks In Development And Evolution.
Not checked in the free run.
- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
- Interpretationcitation
The intersecting expression of Wnt and TGF-β at the posterior end of the larva later in development is compatible with these signalling pathways regulating the formation of the pigment ring.
“The intersecting expression of Wnt and TGF-β at the posterior end of the larva later in development also is compatible with these signalling pathways regulating the formation of the pigment ring [i.e. tissue morphogenesis, 22].”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites [22] BM Degnan, 2005, Sponge development and antiquity of animal pattern formation., Integr Comp Biol source
Not checked in the free run.
- May combine two claims. 12
- Classified as probably not a substantial claim. 6
May combine two claims.
Findingown dataOf the 7 cysteines conserved in the TGF-β superfamily signalling domain, 6 are present in the Amphimedon sequence, with cysteine 4 missing.
“Of the 7 cysteines that are conserved in the signalling domain of TGF-β superfamily, 6 are present in the Amphimedon sequence (Fig. S4). Cysteine 4 is missing, as it is the case in mouse GDF3, GDF9 and BMP15 proteins [40].”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [40] AC McPherron, 1993, GDF-3 and GDF-9: two new members of the transforming growth factor- β superfamily containing a novel pattern of cysteines., J Biol Chem source
Not checked in the free run.
May combine two claims.
Findingown dataDuring gastrulation, TGF-β expression becomes restricted to the outer layer, with stronger domains of expression at anterior and posterior poles of the embryo.
“During gastrulation, TGF-β expression becomes restricted to the outer layer, with stronger domains of expression at anterior and posterior poles of the embryo (Fig 3C, D).”
Quote in the paperSubstantial claimMay combine two claims.
Findingown dataTGF-β expression in the embryo gradually decreases, and transcripts are not detected in the swimming larvae.
“TGF-β expression in the embryo gradually decreases, and the transcripts are not detected in the swimming larvae (not shown).”
Quote in the paperNot a substantial claimMay combine two claims.
Findingown dataAt the blastula stage, TGF-β-expressing cells are more prominent in the outer region, while Wnt expressing cells are enriched in the inner region.
“However, at the blastula stage TGF-β-expressing cells are more prominent in the outer region (Fig. 3B), while Wnt expressing cells are enriched in the inner region (Fig. 2A)”
Quote in the paperSubstantial claimMay combine two claims.
FindingcitationThe deduced Amphimedon Wnt protein contains a signal peptide and 24 conserved cysteines characteristic of the Wnt family.
“The deduced Amphimedon Wnt protein contains a signal peptide and 24 conserved cysteines characteristic for this family [38], [39] (Fig. S1)”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [38], [39]
Not checked in the free run.
May combine two claims.
Findingown dataTGF-β expression is first detectable during cleavage stage in small micromeres, which do not appear cytologically different from the Wnt expressing cells.
“Similar to Wnt expression, TGF-β expression is first detectable during cleavage stage in small micromeres, which do not appear cytologically different from the Wnt expressing cells (Fig. 3A).”
Quote in the paperSubstantial claimMay combine two claims.
FindingcitationThe Amphimedon TGF-β preprotein contains a signal peptide and a conserved proteolytic cleavage site RTRRS.
“The preprotein contains a signal peptide and a conserved proteolytic cleavage site RTRRS, lending further support to its assignment to this signalling protein family (Fig. S5) [41].”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites [41] E Ozkaynak, 1992, Osteogenic protein-2. A new member of the transforming growth factor- β superfamily expressed early in embryogenesis., J Biol Chem source
Not checked in the free run.
May combine two claims.
Findingown dataWnt-expressing cells are restricted early to the posterior pole and Wnt transcripts localize to this pole continuously through to the larval stage.
“Regardless, it is evident that Wnt-expressing cells are restricted early to the posterior pole and Wnt transcripts localize to this pole continuously through to the larval stage.”
Quote in the paperSubstantial claimMay combine two claims.
Findingown dataThe localization of Wnt-expressing cells to the future posterior pole is the earliest morphogenetic asymmetry detected in Amphimedon, occurring prior to the initial cell sorting event that creates the embryonic cell layers.
“The localization of Wnt-expressing cells to the future posterior pole is the earliest morphogenetic asymmetry detected in Amphimedon (Fig. 2C, D), occurring prior to the initial cell sorting event that creates the embryonic cell layers.”
Quote in the paperSubstantial claimMay combine two claims.
InterpretationcitationBecause cysteine 4 is responsible for intermolecular disulfide bond formation in a mature dimer, Amphimedon TGF-β can act as a monomer or form a non-covalent dimer.
“Since this particular cysteine is responsible for intermolecular disulfide bond formation in a mature dimer, it appears that the Amphimedon TGF-β can act as a monomer or forms a non-covalent dimer [40].”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites [40] AC McPherron, 1993, GDF-3 and GDF-9: two new members of the transforming growth factor- β superfamily containing a novel pattern of cysteines., J Biol Chem source
Not checked in the free run.
Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.
Study design and conductnone givenFor TGF-β, the RACE primer encompassed the stop codon and several independent clones constituted the entire ORF.
“In case of TGF−β, the RACE primer encompassed the stop codon and several independent clones constituted the entire ORF.”
Quote in the paperNot a substantial claimProbably not a substantial claim: may not pass S3 (load-bearing).
PremisecitationTCF and SMAD, as respective effectors of the Wnt and TGF-β pathways, cooperate to regulate gene expression.
“with TCF and SMAD, as respective effectors of these pathways, cooperating to regulate gene expression [31].”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites [31] M Nishita, 2000, Interaction between Wnt and TGF-β signaling pathways during formation of Spemann's organizer., Nature source
Not checked in the free run.
Probably not a substantial claim: may not pass S3 (load-bearing).
Study design and conductown dataThe complete coding sequence of Wnt was confirmed by RT-PCR of embryonic RNA.
“In case of Wnt, the complete coding sequence was confirmed by RT-PCR of embryonic RNA (using primers: CATTGACGTACAGCTACAAAG and CATGTTCTTGTGAATAGACTC).”
Quote in the paperNot a substantial claimClassified as probably not a substantial claim.
InterpretationcitationThe primacy of Wnt and TGF-β pathways in intercellular communication and cell fate diversification suggests that their evolution may have been concomitant with the origin of multicellularity.
“The primacy of Wnt and TGF-β pathways in intercellular communication and cell fate diversification suggests that their evolution may have been concomitant with the origin of multicellularity [22], [37].”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [22], [37]
Not checked in the free run.
May combine two claims.
InterpretationreasoningThese signalling systems evolved and interacted early in metazoan evolution prior to the first cladogenic events that predate the Cambrian explosion.
“These signalling systems evolved and interacted early in metazoan evolution prior to the first cladogenic events that predate the Cambrian explosion (Fig. 4).”
Quote in the paperSubstantial claim- Rests on an assumption: The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
Classified as probably not a substantial claim.
PremisecitationExpression of Wnt genes is associated with blastopore and site of gastrulation in cnidarian and chordate embryos.
“For example, the expression of Wnt genes is associated with blastopore and site of gastrulation in cnidarian and chordate embryos [3], [5], [8], [9].”
Quote in the paperSubstantial claim0 of 1 sources checked- cites [3], [5], [8], [9]
Not checked in the free run.
Probably not a substantial claim: may not pass S3 (load-bearing).
PremisecitationThe vertebrate organizer is localized by interactions between Wnt and TGF-β signalling pathways.
“For example, the vertebrate organizer is localized by interactions between Wnt and TGF-β signalling pathways [29]–[31], with TCF and SMAD, as respective effectors of these pathways, cooperating to regulate gene expression [31].”
Quote in the paperNot a substantial claim0 of 1 sources checked- cites [29]–[31]
Not checked in the free run.
The paper relies on this without support.
The expression patterns of Wnt and TGF-β in Amphimedon embryos and larvae reflect the ancestral metazoan condition.
“We infer from the expression of Wnt and TGF-β in Amphimedon that the ancestor that gave rise to sponges, cnidarians and bilaterians had already evolved the capacity to direct the formation of relatively sophisticated body plans, with axes and tissues.”
The paper relies on this without support.
The anterior-posterior axis of Amphimedon embryos and larvae is comparable to the ancestral metazoan anterior-posterior axis.
“The radially symmetrical expression patterns of Wnt and TGF-β along the anterior-posterior axis of sponge embryos and larvae suggest that these signalling pathways contributed to establishing axial polarity in the very first metazoans.”
The authors state this as an assumption.
The last common ancestor to all living metazoans can be reconstructed by identifying common features in embryonic development of distantly related extant clades.
“We can reconstruct this hypothetical animal–the Urmetazoa–by identifying common features in embryonic development of distantly related extant clades, specifically bilaterians, cnidarians, ctenophores and sponges.”
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In ciliated larvae, Wnt signalling is the likely ancestral regulator of axial body polarity and planar polarity of cilia.
“In ciliated larvae, Wnt signalling is the likely ancestral regulator of establishing axial polarity of the body and the planar polarity of cilia.”
From An option space for early neural evolution (2015) · cites this paper as [21]
One of the three Amphimedon Wnt ligands is specifically expressed in the posterior pole of embryos and larvae, and one of the eight Amphimedon Tgfb ligands is expressed in the outer embryonic layer and then restricted to the posterior pole.
“One of the three Amphimedon Wnt ligands is specifically expressed in the posterior pole of the embryos and larvae, and one of the eight Amphimedon Tgfb ligands is expressed in the outer embryonic layer, and then restricted to the posterior pole 7,48 .”
From Developmental gene expression provides clues to relationships between sponge and eumetazoan body plans (2014) · cites this paper as [48]
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
Each contradiction between two passages listed here was confirmed by an independent check.
Blastula-stage Wnt expression is cited to a cleavage-stage panel
MinorThe text cites Figure 2A for Wnt-expressing cells being enriched in the inner region at the blastula stage, but the Figure 2 caption identifies panel A as cleavage-stage expression and panel B as the blastula stage.
“at the blastula stage TGF-β-expressing cells are more prominent in the outer region (Fig. 3B), while Wnt expressing cells are enriched in the inner region (Fig. 2A)”
“(A) During cleavage, Wnt is expressed in micromeres distributed throughout the early embryo. (B) At the blastula stage, Wnt-expressing cells are predominantly localised interiorly.”
Cites
Requirement for Wnt3 in vertebrate axis formation
Liu, P., Wakamiya, M., Shea, M. J., Albrecht, U., Behringer, R. R., & Bradley, A. (1999) · Nature Genetics · doi:10.1038/11932 · Cited by 900 · see citing works
Nusse, R., & VARMUS, H. E. (1992) · Cell · doi:10.1016/0092-8674(92)90630-u · Cited by 814 · see citing works
Unexpected complexity of the Wnt gene family in a sea anemone
Kusserow, A., Pang, K., Sturm, C., Hrouda, M., Lentfer, J., Schmidt, H. A., Technau, U., von Haeseler, A., Hobmayer, B., Martindale, M. Q., et al. (2005) · Nature · doi:10.1038/nature03158 · Cited by 599 · see citing works
Precambrian Sponges with Cellular Structures
Li, C.-W., Chen, J.-Y., & Hua, T.-E. (1998) · Science · doi:10.1126/science.279.5352.879 · Cited by 489 · see citing works
The New View of Animal Phylogeny
Halanych, K. M. (2004) · Annual Review of Ecology, Evolution, and Systematics · doi:10.1146/annurev.ecolsys.35.112202.130124 · Cited by 489 · see citing works
Interaction between Wnt and TGF-β signalling pathways during formation of Spemann's organizer
Nishita, M., Hashimoto, M. K., Ogata, S., Laurent, M. N., Ueno, N., Shibuyà, H., & Cho, K. W. Y. (2000) · Nature · doi:10.1038/35001602 · Cited by 466 · see citing works
The establishment of spemann's organizer and patterning of the vertebrate embryo
De Robertis, E. M., Larraín, J., Oelgeschläger, M., & Wessely, O. (2000) · Nature Reviews Genetics · doi:10.1038/35042039 · Cited by 429 · see citing works
Medina, M., Collins, A. G., Silberman, J. D., & Sogin, M. L. (2001) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.171316998 · Cited by 395 · see citing works
Peterson, K. J., & Butterfield, N. J. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0503660102 · Cited by 361 · see citing works
Early evolution of animal cell signaling and adhesion genes
Nichols, S., Dirks, W., Pearse, J. S., & King, N. (2006) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0604065103 · Cited by 327 · see citing works
The last common bilaterian ancestor
Erwin, D. H., & Davidson, E. H. (2002) · Development · doi:10.1242/dev.129.13.3021 · Cited by 320 · see citing works
McPherron, A. C., & Lee, S. (1993) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(18)53714-5 · Cited by 319 · see citing works
A Post-Synaptic Scaffold at the Origin of the Animal Kingdom
Sakarya, O., Armstrong, K. A., Adamska, M., Adamski, M., Wang, I.-F., Tidor, B., Degnan, B. M., Oakley, T. H., & Kosik, K. S. (2007) · PLoS ONE · doi:10.1371/journal.pone.0000506 · Cited by 291 · see citing works
Self-citationFormation of the head organizer in hydra involves the canonical Wnt pathway.
Broun, M., Gee, L., Reinhardt, B., & Bode, H. R. (2005) · Development · doi:10.1242/dev.01848 · Cited by 287 · see citing works
Simionato, E., Ledent, V., Richards, G. S., Thomas‐Chollier, M., Kerner, P., Coornaert, D., Degnan, B. M., & Vervoort, M. (2007) · BMC Evolutionary Biology · doi:10.1186/1471-2148-7-33 · Cited by 286 · see citing works
Self-citationSponge paraphyly and the origin of Metazoa
Borchiellini, C., Manuel, M., Alivon, E., Boury-Esnault, N., Vacelet, J., & Le Parco, Y. (2001) · Journal of Evolutionary Biology · doi:10.1046/j.1420-9101.2001.00244.x · Cited by 275 · see citing works
Özkaynak, E., Schnegelsberg, P. N. J., Jin, D.-H., et al. (1992) · Journal of Biological Chemistry · doi:10.1016/s0021-9258(19)74028-9 · Cited by 266 · see citing works
One hundred years of positional information.
Wolpert, L. (1996) · Trends in Genetics · doi:10.1016/s0168-9525(96)80019-9 · Cited by 265 · see citing works
Phylogeny of Choanozoa, Apusozoa, and Other Protozoa and Early Eukaryote Megaevolution
Cavalier‐Smith, T., & Chao, E. E. Y. (2003) · Journal of Molecular Evolution · doi:10.1007/s00239-002-2424-z · Cited by 250 · see citing works
Allocation of the thoracic imaginal primordia in the <i>Drosophila</i> embryo
Cohen, B., Simcox, A. A., & Cohen, S. M. (1993) · Development · doi:10.1242/dev.117.2.597 · Cited by 247 · see citing works
Molecular evidence for deep evolutionary roots of bilaterality in animal development
Matus, D. Q., Pang, K., Marlow, H. Q., Dunn, C. W., Thomsen, G. H., & Martindale, M. Q. (2006) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0601257103 · Cited by 227 · see citing works
Zhou, S., Eid, K., & Glowacki, J. (2004) · Journal of Bone and Mineral Research · doi:10.1359/jbmr.0301239 · Cited by 226 · see citing works
Watabe, T., Kim, S., Candia, A. F., Rothbächer, U., Hashimoto, C., Inoue, K., & Cho, K. W. (1995) · Genes & Development · doi:10.1101/gad.9.24.3038 · Cited by 224 · see citing works
The evolution of metazoan axial properties
Martindale, M. Q. (2005) · Nature Reviews Genetics · doi:10.1038/nrg1725 · Cited by 204 · see citing works
Sponge phylogeny, animal monophyly, and the origin of the nervous system: 18S rRNA evidence
Cavalier-Smith, T., Allsopp, M. T. E. P., Chao, E. E., Boury-Esnault, N., & Vacelet, J. (1996) · Canadian Journal of Zoology · doi:10.1139/z96-231 · Cited by 180 · see citing works
A WNT of things to come: Evolution of Wnt signaling and polarity in cnidarians
LEE, P., PANG, K., Matus, D. Q., & Martindale, M. Q. (2006) · Seminars in Cell and Developmental Biology · doi:10.1016/j.semcdb.2006.05.002 · Cited by 180 · see citing works
Larroux, C., Fahey, B., Liubicich, D., Hinman, V. F., Gauthier, M., Gongora, M., Green, K., Wörheide, G., Leys, S. P., & Degnan, B. M. (2006) · Evolution & Development · doi:10.1111/j.1525-142x.2006.00086.x · Cited by 173 · see citing works
Self-citationThe NK homeobox gene cluster predates the origin of Hox genes.
Larroux, C., Fahey, B., Degnan, S. M., Adamski, M., Rokhsar, D. S., & Degnan, B. M. (2007) · Current Biology · doi:10.1016/j.cub.2007.03.008 · Cited by 173 · cited 1× · see citing works
“Along with the diversification signalling pathways in eumetazoans was the origination of Hox genes [24] and expansion of a range of developmental transcription factor gene families [23, 28, unpublished], which enabled further elaboration of ancestral gene regulatory networks.”
BackgroundSelf-citationRentzsch, F., Anton, R., Saina, M., Hammerschmidt, M., Holstein, T. W., & Technau, U. (2006) · Developmental Biology · doi:10.1016/j.ydbio.2006.06.003 · Cited by 169 · see citing works
Manuel, M., Borchiellini, C., Alivon, E., Parco, Y. L., Vacelet, J., & Boury‐Esnault, N. (2003) · Systematic Biology · doi:10.1080/10635150309322 · Cited by 158 · see citing works
Leys, S. P., & Degnan, B. M. (2002) · Invertebrate Biology · doi:10.1111/j.1744-7410.2002.tb00058.x · Cited by 138 · see citing works
Self-citationThe evolutionary origin of hedgehog proteins
Adamska, M., Matus, D. Q., Adamski, M., Green, K., Rokhsar, D. S., Martindale, M. Q., & Degnan, B. M. (2007) · Current Biology · doi:10.1016/j.cub.2007.08.010 · Cited by 137 · see citing works
Self-citationSponge Paleogenomics Reveals an Ancient Role for Carbonic Anhydrase in Skeletogenesis
Jackson, D. J., Macis, L., Joachim Reitner, A., Degnan, B. M., & Wörheide, G. (2007) · Science · doi:10.1126/science.1141560 · Cited by 136 · see citing works
Self-citationSoshnikova, N. V., Zechner, D., Huelsken, J., Mishina, Y. M., Behringer, R. R., Taketo, M. M., Crenshaw, E. B., & Birchmeier, W. (2003) · Genes & Development · doi:10.1101/gad.263003 · Cited by 136 · see citing works
Localized expression of a <i>dpp</i> / <i>BMP2</i> / <i>4</i> ortholog in a coral embryo
Hayward, D. C., Samuel, G., Pontynen, P. C., Catmull, J., Saint, R., Miller, D. J., & Ball, E. E. (2002) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.112021499 · Cited by 132 · see citing works
Cnidarians and ancestral genetic complexity in the animal kingdom
Miller, D. J., Ball, E. E., & Technau, U. (2005) · Trends in Genetics · doi:10.1016/j.tig.2005.08.002 · Cited by 122 · see citing works
Botting, J. P., & Butterfield, N. J. (2005) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.0405867102 · Cited by 110 · see citing works
HyBMP5-8b , a BMP5-8 orthologue, acts during axial patterning and tentacle formation in hydra
Reinhardt, B., Broun, M., Blitz, I. L., & Bode, H. R. (2003) · Developmental Biology · doi:10.1016/j.ydbio.2003.10.031 · Cited by 101 · see citing works
Morphogen gradients, positional information, and Xenopus: Interplay of theory and experiment
Green, J. B. A. (2002) · Developmental Dynamics · doi:10.1002/dvdy.10170 · Cited by 98 · see citing works
Adell, T., Nefkens, I., & Müller, W. E. G. (2003) · FEBS Letters · doi:10.1016/s0014-5793(03)01190-6 · Cited by 94 · see citing works
Maves, L., & Schubiger, G. (1998) · Development · doi:10.1242/dev.125.1.115 · Cited by 79 · see citing works
Nodal/activin signaling establishes oral–aboral polarity in the early sea urchin embryo
Flowers, V. L., Courteau, G. R., Poustka, A. J., et al. (2004) · Developmental Dynamics · doi:10.1002/dvdy.20194 · Cited by 68 · see citing works
Developmental expression of AmphiWnt1, an amphioxus gene in the Wnt1/wingless subfamily
Holland, L. Z., Holland, N. D., & Schubert, M. (2000) · Development Genes and Evolution · doi:10.1007/s004270000089 · Cited by 66 · see citing works
Isolation and characterization of Wnt pathway‐related genes from Porifera
Adell, T., Thakur, A. N., & Müller, W. E. G. (2007) · Cell Biology International · doi:10.1016/j.cellbi.2007.03.003 · Cited by 60 · see citing works
Sponge Development and Antiquity of Animal Pattern Formation
Degnan, B. M. (2005) · Integrative and Comparative Biology · doi:10.1093/icb/45.2.335 · Cited by 54 · see citing works
Self-citationSuga, H., Ono, K., & Miyata, T. (1999) · FEBS Letters · doi:10.1016/s0014-5793(99)00749-8 · Cited by 45 · see citing works
Flagged first, then by citations
Cited by
Sorted by citations
Gurtner, G. C., Werner, S., Barrandon, Y., & Longaker, M. T. (2008) · Nature · doi:10.1038/nature07039 · Cited by 6,542 · see citing works
The Amphimedon queenslandica genome and the evolution of animal complexity
Srivastava, M., Simakov, O., Chapman, J., Fahey, B., Gauthier, M. E. A., Mitros, T., Richards, G. S., Conaco, C., Dacre, M., Hellsten, U., et al. (2010) · Nature · doi:10.1038/nature09201 · Cited by 1,049 · see citing works
Self-citationThe Trichoplax genome and the nature of placozoans
Srivastava, M., Begovic, E., Chapman, J., Putnam, N. H., Hellsten, U., Kawashima, T., Kuo, A., Mitros, T., Salamov, A., Carpenter, M. L., et al. (2008) · Nature · doi:10.1038/nature07191 · Cited by 889 · see citing works
Phylogenomics Revives Traditional Views on Deep Animal Relationships
Philippe, H., Derelle, R., Lopez, P., Pick, K., Borchiellini, C., Boury-Esnault, N., Vacelet, J., Renard, E., Houliston, E., Quéinnec, E., et al. (2009) · Current Biology · doi:10.1016/j.cub.2009.02.052 · Cited by 695 · see citing works
Riesgo, A., Farrar, N., Windsor, P. J., Giribet, G., & Leys, S. P. (2014) · Molecular Biology and Evolution · doi:10.1093/molbev/msu057 · Cited by 266 · see citing works
Jékely, G. (2009) · Philosophical Transactions of the Royal Society B Biological Sciences · doi:10.1098/rstb.2009.0072 · Cited by 263 · see citing works
The Genomic and Cellular Foundations of Animal Origins
Richter, D. J., & King, N. (2013) · Annual Review of Genetics · doi:10.1146/annurev-genet-111212-133456 · Cited by 196 · see citing works
An option space for early neural evolution
Jékely, G., Keijzer, F., & Godfrey-Smith, P. (2015) · Philosophical Transactions of the Royal Society B: Biological Sciences · doi:10.1098/rstb.2015.0181 · Cited by 171 · see citing works
Origins of neurogenesis, a cnidarian view
Galliot, B., Quiquand, M., Ghila, L., de Rosa, R., Miljkovic-Licina, M., & Chera, S. (2009) · Developmental Biology · doi:10.1016/j.ydbio.2009.05.563 · Cited by 168 · see citing works
Deep Phylogeny and Evolution of Sponges (Phylum Porifera)
Wörheide, G., Dohrmann, M., Erpenbeck, D., Larroux, C., Maldonado, M., Voigt, O., Borchiellini, C., & Lavrov, D. V. (2012) · Advances in Marine Biology · doi:10.1016/b978-0-12-387787-1.00007-6 · Cited by 166 · see citing works
Self-citationSponge Genes Provide New Insight into the Evolutionary Origin of the Neurogenic Circuit
Richards, G. S., Simionato, E., Perron, M., Adamska, M., Vervoort, M., & Degnan, B. M. (2008) · Current Biology · doi:10.1016/j.cub.2008.06.074 · Cited by 165 · see citing works
Self-citationLeininger, S., Adamski, M., Bergum, B., Guder, C., Liu, J., Laplante, M., Bråte, J., Hoffmann, F., Fortunato, S., Jordal, S., et al. (2014) · Nature Communications · doi:10.1038/ncomms4905 · Cited by 136 · see citing works
Self-citationAdamska, M., Larroux, C., Adamski, M., Green, K., Lovas, E., Koop, D., Richards, G. S., Zwafink, C., & Degnan, B. M. (2010) · Evolution & Development · doi:10.1111/j.1525-142x.2010.00435.x · Cited by 139 · see citing works
Self-citationGenomic insights into Wnt signaling in an early diverging metazoan, the ctenophore Mnemiopsis leidyi
Pang, K., Ryan, J. F., Program, N. C. S., Mullikin, J. C., Baxevanis, A. D., & Martindale, M. Q. (2010) · EvoDevo · doi:10.1186/2041-9139-1-10 · Cited by 115 · see citing works
Evolution of the TGF-β Signaling Pathway and Its Potential Role in the Ctenophore, Mnemiopsis leidyi
Pang, K., Ryan, J. F., Baxevanis, A. D., & Martindale, M. Q. (2011) · PLoS ONE · doi:10.1371/journal.pone.0024152 · Cited by 93 · see citing works
Physico-Genetic Determinants in the Evolution of Development
Newman, S. A. (2012) · Science · doi:10.1126/science.1222003 · Cited by 92 · see citing works
Degnan, S. M., & Degnan, B. M. (2010) · Philosophical Transactions of the Royal Society B: Biological Sciences · doi:10.1098/rstb.2009.0248 · Cited by 71 · see citing works
Self-citationThe mouth, the anus, and the blastopore—open questions about questionable openings
Hejnol, A., & Martindale, M. Q. (2009) · Animal Evolution · doi:10.1093/acprof:oso/9780199549429.003.0004 · Cited by 37 · see citing works
The Origin of Metazoan Multicellularity: A Potential Microbial Black Swan Event
Ruiz-Trillo, I., Kin, K., & Casacuberta, E. (2023) · Annual Review of Microbiology · doi:10.1146/annurev-micro-032421-120023 · Cited by 36 · see citing works
Marshal, C. R., & Valentine, J. W. (2009) · Evolution · doi:10.1111/j.1558-5646.2009.00908.x · Cited by 30 · see citing works
Origin of Metazoan Developmental Toolkits and Their Expression in the Fossil Record
Tweedt, S. M., & Erwin, D. H. (2015) · Advances in Marine Genomics · doi:10.1007/978-94-017-9642-2_3 · Cited by 27 · see citing works
Genomic, phylogenetic, and cell biological insights into metazoan origins
Nichols, S. A., Dayel, M. J., & King, N. (2009) · Animal Evolution · doi:10.1093/acprof:oso/9780199549429.003.0003 · Cited by 24 · see citing works
- Authors
- Adamska, M., Degnan, S. M., Green, K. M., Adamski, M., Craigie, A., Larroux, C., & Degnan, B. M.
- Affiliations
- The University of Queensland (AU)
- Venue
- PLoS ONE
- Publisher
- Public Library of Science (PLoS)
- Published
- 2007-10-10
- Volume
- 2
- Issue
- 10
- Pages
- e1031
- ISSN
- 1932-6203 (ISSN-L)
- PMC
- PMC2000352
- OpenAlex
- W2002134090
- Cited by
- 257
- References
- 46
- Citations by year
- 2026: 1 · 2025: 7 · 2024: 8 · 2023: 7 · 2022: 10 · 2021: 14 · 2020: 7 · 2019: 16 · 2018: 13 · 2017: 8 · 2016: 19 · 2015: 13 · 2014: 8 · 2013: 9 · 2012: 14
- FWCI
- 21.91
- Type
- journal article
- Language
- en
- Open access
- gold
- doi.org
- Locations
- PLoS ONE (publishedVersion, cc-by)
- PubMed Central (publishedVersion, cc-by)
- PubMed (publishedVersion)
- OSTI OAI (U.S. Department of Energy Office of Scientific and Technical Information) (submittedVersion)
- DOAJ (DOAJ: Directory of Open Access Journals) (submittedVersion)
- Figshare (submittedVersion, cc-by)
- Funders
- U.S. Department of Energy
- Joint Genome Institute
- Australian Research Council
- Topics
- Physical Sciences › Earth and Planetary Sciences › Paleontology › Marine Invertebrate Physiology and Ecology
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Developmental Biology and Gene Regulation
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Biotechnology › Marine Sponges and Natural Products
- Keywords
- Wnt signaling, TGF-beta signaling, Amphimedon queenslandica, anterior-posterior axis, axial polarity, gene expression patterns, sponges
- MeSH terms
- Animals, Cell Adhesion, Cell Differentiation, Ligands, Models, Biological, Phylogeny, Porifera, Signal Transduction, Transforming Growth Factor beta, In Situ Hybridization, DNA, Complementary, Gene Expression Regulation, Developmental, Body Patterning, Wnt Proteins
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-10-06.
Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-10-06.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
