Investigation of Oxtr-expressing Neurons Projecting to Nucleus Accumbens using Oxtr-ires-Cre Knock-in prairie Voles (Microtus ochrogaster)

“Cas9 induces a double strand break into the target sequence and insertions or deletions are induced into the target sequence while it is repaired by endogenous DNA repair pathways (Cho et al., 2013; Cong et al., 2013; Mali et al., 2013; Wang et al., 2013).”

“Cas9 induces a double strand break into the target sequence and insertions or deletions are induced into the target sequence while it is repaired by endogenous DNA repair pathways (Cho et al., 2013; Cong et al., 2013; Mali et al., 2013; Wang et al., 2013).”

“The CRISPR/Cas system is an RNA-based adaptive immune system of archaea and bacteria against bacteriophage or foreign nucleic acids (Barrangou et al., 2007; Wiedenheft et al., 2012).”

“Cas9 induces a double strand break into the target sequence and insertions or deletions are induced into the target sequence while it is repaired by endogenous DNA repair pathways (Cho et al., 2013; Cong et al., 2013; Mali et al., 2013; Wang et al., 2013).”

“CRISPR/Cas9 system derived from Streptococcus pyogenes is in the Type II – A CRISPR/Cas system consisting of Cas9 nuclease and two short RNAs, crispr RNA (crRNA) and trans activating crRNA (tracrRNA) (Deltcheva et al., 2011).”

“Cas9 induces a double strand break into the target sequence and insertions or deletions are induced into the target sequence while it is repaired by endogenous DNA repair pathways (Cho et al., 2013; Cong et al., 2013; Mali et al., 2013; Wang et al., 2013).”

“The CRISPR/Cas system is an RNA-based adaptive immune system of archaea and bacteria against bacteriophage or foreign nucleic acids (Barrangou et al., 2007; Wiedenheft et al., 2012).”

“Oxytocin (OXT) and oxytocin receptor (OXTR) are one of the key neuromodulators and receptors mediating pair bond formation and maintenance in prairie voles (Donaldson and Young, 2008; Smith and Wang, 2014; Barrett et al., 2015; Bosch, et al., 2016; Johnson et al., 2016, 2017; Walum and Young, 2018).”

“The prairie vole (Microtus ochrogaster) is a monogamous rodent species showing enduring pair bonding between mates, biparental care, and the consoling behavior toward a distressed partner (Young and Wang, 2004; Aragona et al., 2006; Gobrogge et al., 2009; Young et al., 2011; Johnson and Young, 2015; Burkett et al., 20…”

“Although we targeted the entire NAcc and didn’t distinguish between core and shell, we found that Oxtrexpressing neurons in ACC had projections to NAcc in prairie voles, which was not found in previous studies of mice (Dolen et al., 2013).”

“OXT/OXTR signaling acts as a neuromodulator affecting social and sexual behavior, stress coping, and the processing of social stimuli, in many species (Knobloch et al., 2012; Dolen et al., 2013; Choe et al., 2015; Marlin et al., 2015; Wei et al., 2015; Oettl et al., 2016; Yokoi et al., 2020).”

“OXT binds to OXTR, which is a G protein coupled receptor coupling with Gaq/11 and transducing intracellular signaling (Jurek and Neumann, 2018).”

“Although the expression of Oxtr in brains of prairie voles has shown by autoradiography (Witt et al., 1991; Insel and Shapiro, 1992), it has not been possible to visualize Oxtr expressing neurons at a cellular level, or examine their projections in prairie voles.”

“Social bonds such as the close and enduring attachments between parents and infants or between opposite sex mates in monogamous mammals can play a critical role in promoting mental and physical well-being (Feldman, 2012).”

“OXT/OXTR signaling acts as a neuromodulator affecting social and sexual behavior, stress coping, and the processing of social stimuli, in many species (Knobloch et al., 2012; Dolen et al., 2013; Choe et al., 2015; Marlin et al., 2015; Wei et al., 2015; Oettl et al., 2016; Yokoi et al., 2020).”

“The prairie vole (Microtus ochrogaster) is a monogamous rodent species showing enduring pair bonding between mates, biparental care, and the consoling behavior toward a distressed partner (Young and Wang, 2004; Aragona et al., 2006; Gobrogge et al., 2009; Young et al., 2011; Johnson and Young, 2015; Burkett et al., 20…”

“The vCA1 to NAcc circuit is known as a region storing social memory in mice (Okuyama et al., 2016).”

“A previous mouse study showed that NAcc core had afferent inputs of Oxtr-expressing neurons from PVN, AON, PVT, BLA, central amygdala (CeA), cortical amygdala (CoA), ventral tegmental area (VTA), dorsal raphe nucleus (dRph), ventral subiculum, and ventral hippocampal CA1 (vCA1) by combining the immunostaining of Oxtr-…”

“Oxtrexpressing neurons in PrL has been proven to regulate the reward processing, social behavior, anxiety, and affiliation behaviors (Young et al., 2001; Sabihi et al., 2014; Everett et al., 2019; He et al., 2019).”

“The BLA to NAcc circuit regulates reward seeking in mice (Ambroggi et al., 2008) and OXT in the amygdala plays a role in regulating social decision-making in non-human primates (Chang et al., 2015).”

“The prairie vole (Microtus ochrogaster) is a monogamous rodent species showing enduring pair bonding between mates, biparental care, and the consoling behavior toward a distressed partner (Young and Wang, 2004; Aragona et al., 2006; Gobrogge et al., 2009; Young et al., 2011; Johnson and Young, 2015; Burkett et al., 20…”

“The prairie vole (Microtus ochrogaster) is a monogamous rodent species showing enduring pair bonding between mates, biparental care, and the consoling behavior toward a distressed partner (Young and Wang, 2004; Aragona et al., 2006; Gobrogge et al., 2009; Young et al., 2011; Johnson and Young, 2015; Burkett et al., 20…”

“Oxytocin (OXT) and oxytocin receptor (OXTR) are one of the key neuromodulators and receptors mediating pair bond formation and maintenance in prairie voles (Donaldson and Young, 2008; Smith and Wang, 2014; Barrett et al., 2015; Bosch, et al., 2016; Johnson et al., 2016, 2017; Walum and Young, 2018).”

“In AON, Oxtr-expressing neurons facilitates social recognition by increasing the signal to noise ratio in olfactory bulb (Oettl et al., 2016).”

“The BLA has been proposed as a key brain region regulating pair bonding as well (Numan and Young, 2016; Walum and Young, 2018).”

“The BLA has been proposed as a key brain region regulating pair bonding as well (Numan and Young, 2016; Walum and Young, 2018).”

“OXT is produced in neurons in the paraventricular nucleus (PVN) and supraoptic nucleus of the hypothalamus and their projections course throughout the forebrain (Ross et al., 2009; Johnson and Young, 2017; Rogers et al., 2018).”

“Microinjecting Cas9 nuclease protein, synthetic crRNA, and tracrRNA to the nucleus and cytoplasm of embryos instead of microinjecting Cas9 mRNA and single guide RNA dramatically improved knock-in efficiency in mouse (Aida et al., 2015).”

“Blockade of OXTR in IC disrupted social approach behaviors in rats (Rogers-Carter et al., 2018).”

“Prairie voles have proven to be an ideal model for investigating brain mechanisms that regulate social bonding though studying the pair bond (McGraw and Young, 2010; Walum and Young, 2018).”

“OXT is produced in neurons in the paraventricular nucleus (PVN) and supraoptic nucleus of the hypothalamus and their projections course throughout the forebrain (Ross et al., 2009; Johnson and Young, 2017; Rogers et al., 2018).”

“Adeno associated virus (AAV) has been proven useful as a tracer to visualize afferent and efferent neuronal circuits in rodents (Chamberlin et al., 1998; Tervo et al., 2016).”

“OXT/OXTR signaling acts as a neuromodulator affecting social and sexual behavior, stress coping, and the processing of social stimuli, in many species (Knobloch et al., 2012; Dolen et al., 2013; Choe et al., 2015; Marlin et al., 2015; Wei et al., 2015; Oettl et al., 2016; Yokoi et al., 2020).”

“Recent research has focused on understanding how genes, neuronal modulators, receptors, and circuits regulate social bond formation and maintenance, which may have translational implications for improving quality of life in certain psychiatric disorders such as autism, PTSD, and depression (Modi et al., 2015; Arai et…”

“Oxytocin (OXT) and oxytocin receptor (OXTR) are one of the key neuromodulators and receptors mediating pair bond formation and maintenance in prairie voles (Donaldson and Young, 2008; Smith and Wang, 2014; Barrett et al., 2015; Bosch, et al., 2016; Johnson et al., 2016, 2017; Walum and Young, 2018).”

“Although some circuits projecting to NAcc are known to regulate reward processing in rodents (Zhu et al., 2016; Otis et al., 2019; Lafferty et al., 2020), only a few studies have explored the function and anatomy of these circuits in prairie voles (Amadei, et al.”

“The prairie vole (Microtus ochrogaster) is a monogamous rodent species showing enduring pair bonding between mates, biparental care, and the consoling behavior toward a distressed partner (Young and Wang, 2004; Aragona et al., 2006; Gobrogge et al., 2009; Young et al., 2011; Johnson and Young, 2015; Burkett et al., 20…”

“Also, PVT has been emerging as one of the key brain regions regulating the reward processing (Zhu et al., 2016, 2018; Do-Monte et al., 2017).”

“The prairie vole (Microtus ochrogaster) is a monogamous rodent species showing enduring pair bonding between mates, biparental care, and the consoling behavior toward a distressed partner (Young and Wang, 2004; Aragona et al., 2006; Gobrogge et al., 2009; Young et al., 2011; Johnson and Young, 2015; Burkett et al., 20…”

“Disruption of social bonds can have devastating effects on mental and physical health (Bosch and Young, 2018; Pohl et al., 2019).”

“Another paper showed that Oxtr-expressing neurons in VTA had projections to NAcc in mice by the injection of CRE-dependent AAV-chanelrhodopsin2 (ChR2) into VTA of Oxtr-Cre transgenic mice (Peris et al., 2017).”

“, 2008) and OXT in the amygdala plays a role in regulating social decision-making in non-human primates (Chang et al., 2015).”

“Such polymorphism in non-coding regions are expected in the outbred vole colony as previously described (Okhovat et al., 2015; King et al., 2016).”

“OXTR signaling in the nucleus accumbens (NAcc) plays a particularly important role in pair bond formation and maintenance in prairie voles (Young et al., 2001; Keebaugh et al., 2015).”

“Recent research has focused on understanding how genes, neuronal modulators, receptors, and circuits regulate social bond formation and maintenance, which may have translational implications for improving quality of life in certain psychiatric disorders such as autism, PTSD, and depression (Modi et al., 2015; Arai et…”

“OXT/OXTR signaling acts as a neuromodulator affecting social and sexual behavior, stress coping, and the processing of social stimuli, in many species (Knobloch et al., 2012; Dolen et al., 2013; Choe et al., 2015; Marlin et al., 2015; Wei et al., 2015; Oettl et al., 2016; Yokoi et al., 2020).”

“Oxytocin (OXT) and oxytocin receptor (OXTR) are one of the key neuromodulators and receptors mediating pair bond formation and maintenance in prairie voles (Donaldson and Young, 2008; Smith and Wang, 2014; Barrett et al., 2015; Bosch, et al., 2016; Johnson et al., 2016, 2017; Walum and Young, 2018).”

“PrL is a region that has the projection to NAcc, and this circuit enhances females’ affiliative behavior during the cohabitation in prairie voles (Amadei et al., 2017).”

“By the injection of CRE-dependent AAV-ChR2 into PFC of Oxtr-Cre transgenic mice, the projection of Oxtrexpressing neurons from PFC to NAcc were shown as well (Tan et al., 2019).”

“Oxtrexpressing neurons in PrL has been proven to regulate the reward processing, social behavior, anxiety, and affiliation behaviors (Young et al., 2001; Sabihi et al., 2014; Everett et al., 2019; He et al., 2019).”

“Although the expression of Oxtr in brains of prairie voles has shown by autoradiography (Witt et al., 1991; Insel and Shapiro, 1992), it has not been possible to visualize Oxtr expressing neurons at a cellular level, or examine their projections in prairie voles.”

“These differences of projections between mice, rats, and prairie voles might come from differences in neurotropism between the two retrograde viruses used for the retrograde tracing (Sun et al., 2019).”

“Disruption of social bonds can have devastating effects on mental and physical health (Bosch and Young, 2018; Pohl et al., 2019).”

“Recent research has focused on understanding how genes, neuronal modulators, receptors, and circuits regulate social bond formation and maintenance, which may have translational implications for improving quality of life in certain psychiatric disorders such as autism, PTSD, and depression (Modi et al., 2015; Arai et…”

“Oxtrexpressing neurons in PrL has been proven to regulate the reward processing, social behavior, anxiety, and affiliation behaviors (Young et al., 2001; Sabihi et al., 2014; Everett et al., 2019; He et al., 2019).”

“IC to NAcc circuits have been regarded as the key brain region that regulates social approach behaviors to the stressed juvenile in rats (Rogers-Carter et al., 2019).”

“OXTR autoradiography was performed as described previously (Horie et al., 2019).”

“Although some circuits projecting to NAcc are known to regulate reward processing in rodents (Zhu et al., 2016; Otis et al., 2019; Lafferty et al., 2020), only a few studies have explored the function and anatomy of these circuits in prairie voles (Amadei, et al.”

“OXT/OXTR signaling acts as a neuromodulator affecting social and sexual behavior, stress coping, and the processing of social stimuli, in many species (Knobloch et al., 2012; Dolen et al., 2013; Choe et al., 2015; Marlin et al., 2015; Wei et al., 2015; Oettl et al., 2016; Yokoi et al., 2020).”

“OXT is produced in neurons in the paraventricular nucleus (PVN) and supraoptic nucleus of the hypothalamus and their projections course throughout the forebrain (Ross et al., 2009; Johnson and Young, 2017; Rogers et al., 2018).”

“The Ires-Cre sequence was amplified from the genome of Oxtr-ires-Cre knock-in mouse (Hidema et al., 2016) by PCR with a forward primer 50 – CAGCATGA GCCACCTAGATGGGGGTCCTGGGCC – 30 and a reverse primer 50 – CGCGGTGGGCCAGACCTA ATCGCCATCTTCCAGC – 30 and cloned into pGEMarm linearized by PCR with a forward primer 50 – GTC…”

“In previous studies of prairie voles, GFP expressing transgenic voles were generated by lentiviral mediated transgenesis (Donaldson et al., 2009; Keebaugh et al., 2012).”

“Oxtr-ires-Cre knock-in prairie voles with using CREdependent hM3Dq/hM4Di expression, or ChR2/ halorhodopsin enable researchers to manipulate Oxtrexpressing neural circuits during partner preference tests (Boender and Young, 2020).”

“The insertion of ires sequence is known to affect the expression level of the gene before and after the ires sequence (Cheng et al., 2019).”

“Recent research has focused on understanding how genes, neuronal modulators, receptors, and circuits regulate social bond formation and maintenance, which may have translational implications for improving quality of life in certain psychiatric disorders such as autism, PTSD, and depression (Modi et al., 2015; Arai et…”

“Oxtrexpressing neurons in PrL has been proven to regulate the reward processing, social behavior, anxiety, and affiliation behaviors (Young et al., 2001; Sabihi et al., 2014; Everett et al., 2019; He et al., 2019).”

“Also, prairie vole induced pluripotent cells (iPSCs) have been established by two different groups (Manoli et al., 2012; Katayama et al., 2016).”

“Recent research has focused on understanding how genes, neuronal modulators, receptors, and circuits regulate social bond formation and maintenance, which may have translational implications for improving quality of life in certain psychiatric disorders such as autism, PTSD, and depression (Modi et al., 2015; Arai et…”

“In previous studies of prairie voles, GFP expressing transgenic voles were generated by lentiviral mediated transgenesis (Donaldson et al., 2009; Keebaugh et al., 2012).”

“However, species-specific differences remain an important factor in assessing the translational relevance of these findings as OXT receptor expressing neurons are found in the ACC of prairie voles but not mice [111].”

“…Zheng et al., 2013); therefore, future studies using Cre-dependent retrograde viral tracers inOxtr-Cre prairie volesmay provide behaviorally relevant insight into neural circuitry contributing to mating tactics by identifying the sources of OXTR protein in the hippocampus (Horie et al., 2020).”

“It has been proposed that these regions regulate social reward processing in rats (Ambroggi et al., 2008) and may facilitate pair-bonding in prairie voles (Horie et al., 2020).”

“…of extrahypothalamic regions projecting to the PVN and SON without discrimination of cell types within these nuclei (Sawchenko and Swanson, 1983; Iovino et al., 2016) followed by verification of the synapses onto OT neurons by electrophysiology (Hatton and Yang, 1989; Leng et al., 1999) or…”

“Therefore, OT may share a similar neural target with orexin, glucose, and GLP-1 receptor signaling to promote food motivation by activating NAcprojecting PVT neurons [20, 26, 29].”

“…green) is composed of prelimbic, infralimbic, and olfactory cortex; activity in the vole prefrontal cortex is known to be modulated by hypothalamic oxytocin, and to shape bonding through projections to the nucleus accumbens ( Amadei et al., 2017 ; Burkett et al., 2016 ; Horie et al., 2020 ).”

“Similar disruption of target genes and their corresponding proteins has been reported in other IRES-Cre models [e.g. [50][51]].”

“43 Notably, the gene expression correlations between the ACC and NAc were only found for oxtr and d1r among females that were pregnant or new mothers, and for oprm1a for females that did not breed with their partners.”

“Animals were housed at 25 ◦ C with alternating 14 h periods of light and 10 h periods of dark in Emory University, and were allowed ad libitum access to food (Laboratory Rabbit Diet HF 5326, LabDiet, St. Louis MO, Missouri) and water as described previously (Horie et al., 2020; Horie et al., 2019).”

“…(“PFC,” green) is composed of prelimbic, infralimbic and olfactory cortex; activity in the vole prefrontal cortex is known to be modulated by hypothalamic oxytocin, and to shape bonding through projections to the nucleus accumbens (Amadei et al., 2017; Burkett et al., 2016; Horie et al., 2020).”

“Prairie vole colonies can only be established via wild stock capture and progressive outbreeding [7], resulting in minimal and slow development of transgenic tools [8–13].”

“CRISPR-Cas-based genome editing is not only used routinely in creating standard laboratory rodent models like mice and rats, but has also been used in engineering of non-conventional rodent models, including prairie voles [62, 63] and hamsters [64, 65], as well as livestock [30, 31, 34, 66].”