The DOI matches its Crossref record; 39 of the 40 references it cites were found in a registry or an index.
Valuable products from biotechnology of microalgae
Abstract
The biotechnology of microalgae has gained considerable importance in recent decades. Applications range from simple biomass production for food and feed to valuable products for ecological applications. For most of these applications, the market is still developing and the biotechnological use of microalgae will extend into new areas. Considering the enormous biodiversity of microalgae and recent developments in genetic engineering, this group of organisms represents one of the most promising sources for new products and applications. With the development of sophisticated culture and screening techniques, microalgal biotechnology can already meet the high demands of both the food and pharmaceutical industries.
Overview
Integrity signals
Registry
Cites
Statistics
Verification
Claims the paper makes
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
In the citing paper
“Due to their simple cultivation with high protein content and nutritional value, Chlorella and Arthrospira platensis are at the forefront of the microalgal market [63,78].”
From Challenges in Functional Food Products with the Incorporation of Some Microalgae (2024) · cites this paper as [63]
In the citing paper
“Algae are produced in quantity and sold directly as food and nutrient supplements, while their processed products or extracts are used in biopharmaceuticals and cosmetics [5–7].”
In the citing paper
“The world energy crisis in the 1970s led to the identification of algae as renewable and sustainable sources for biofuels production, prompting the exploration of microalgae as a new field of research for fuels and other valuable products [10, 140].”
From The promising future of microalgae: Current status, challenges, and optimization of a sustainable and renewable industry for biofuels, feed, and other products (2018) · cites this paper as [140]
In the citing paper
“According to one estimate, about 5000 metric tons of dry algal biomass processed for bioproducts generates US$ 1.25 × 109 each year [140].”
From The promising future of microalgae: Current status, challenges, and optimization of a sustainable and renewable industry for biofuels, feed, and other products (2018) · cites this paper as [140]
Citations
Cites
Rogers, L. J. (1988) · FEBS Letters · doi:10.1016/0014-5793(88)80268-0 · Cited by 1,289
Commercial potential for Haematococcus microalgae as a natural source of astaxanthin
Lorenz, R. T., & Cysewski, G. R. (2000) · Trends in biotechnology · doi:10.1016/s0167-7799(00)01433-5 · Cited by 1,190
Modern approach to the classification system of Cyanophytes 4-Nostocales
Komárek, J., & Anagnostidis, K. (1989) · Cited by 1,152
Photobioreactors: Production systems for phototrophic microorganisms
O., P. (2001) · Applied Microbiology and Biotechnology · doi:10.1007/s002530100702 · Cited by 987
Manual on the production and use of live food for aquaculture
Lavens, P., & Sorgeloos, P. (1996) · Medical Entomology and Zoology · Cited by 986
Handbook of Microalgal Culture: Biotechnology and Applied Phycology
(2003) · doi:10.1002/9780470995280 · Cited by 886
Biodiversity and application of microalgae
Metting, F. B. (1996) · Journal of Industrial Microbiology & Biotechnology · doi:10.1007/bf01574779 · Cited by 600
Borowitzka, M. A., & Borowitzka, L. J. (2021) · Royal Society of Chemistry eBooks · doi:10.1039/9781839162473 · Cited by 568
Microalgae as sources of pharmaceuticals and other biologically active compounds
Borowitzka, M. A. (1995) · Journal of Applied Phycology · doi:10.1007/bf00003544 · Cited by 520
Microalgae for aquaculture: Opportunities and constraints
Borowitzka, M. A. (1997) · Journal of Applied Phycology · doi:10.1023/a:1007921728300 · Cited by 478
Research works printed but not linked: 18
- Anagnostidis K, Komárek JA (1985) Modern approach to the classification system of cyanophytes 1?introduction. Arch Hydrobiol Suppl 71:291?302
- Anagnostidis K, Komárek JA (1988) Modern approach to the classification systems of cyanophytes 3?oscillatorales. Arch Hydrobiol Suppl 80:327?472
- De Pauw N, Persoone G (1988) Micro-algae for aquaculture, micro-algal biotechnology. In: Borowitzka MA, Borowitzka LJ (eds) Cambridge University Press, Cambridge, pp 197?221
- Gimmler H, Degenhardt B (2001) In: Rai LC, Gaur JP (eds) Alkaliphilic and alkali-tolerant algae, algal adaptation to environmental stresses. Springer, Berlin Heidelberg New York
- Gross W, Schnarrenberger C (1995) Heterotrophic growth of two strains of the acidothermophilic red alga Galderia sulphuria. Plant Cell Physiol 4:633?638
- Komárek JA, Anagnostidis K (1986) Modern approach to the classification systems of cyanophytes 2-Chroococales. Arch Hydrobiol Suppl 73:157?226
- Kretschmer P, Pulz O, Gudin C, Semenenko V (1995). Biotechnology of Microalgae. (Proceedings of the second European workshop) IGV Institute for Cereal Processing, Potsdam-Rehbrücke
- Laing I, Ayala F (1990) In: Akatsuka I (ed) Commercial mass culture techniques for producing microalgae, introduction to applied phycology. SPB, The Hague, pp 447?477
- Muller-Feuga A, Moal J, Kaas R (2003) The microalgae for aquaculture. In: Stottrup JG, McEvoy LA (eds) Life feeds in marine aquaculture. Blackwell, Oxford
- Musafarov AM, Taubayev TT (1974). Chlorella (in Russian). FAN, Tashkent
- New MB (1999) Global aquaculture: current trends and challenges for 21st century. World Aquacult 3:8?14
- Ördög V, Szigeti J, Pulz O (1996). Proceedings of the conference on progress in plant sciences from plant breeding to growth regulation. Pannon University, Mosonmagyarovar
- Piccardi R, Materassi R, Tredici M (1999) Algae and human affairs in the 21st century. (Abstr Int Conf Appl Algol) Universita degli Studi di Firenze, Firenze
- Richmond A (2004) Handbook of microalgal culture. Blackwell, Oxford
- Schreckenbach K, Thürmer C, Loest K, Träger G, Hahlweg R (2001) Der Einfluss von Mikroalgen (Spirulina platensis) in Trockenmischfutter auf Karpfen (Cyprinus carpio). Fischer Teichwirt 1:10?13
- Sivonen K, Jones G (1999) Cyanobacterial toxins. In: Chorus I, Bertram J (eds) Toxic cyanobacteria in water: a guide to public health significance, monitoring and management. Spon, London, pp 41?111
- Spektorova L, Creswell RL, Vaughan D (1997) Closed tubular cultivators. World Aquacult 6:39?43
- Weber M, Grimmer A (2001) Lohnt sich der Einsatz von Grünalgen im Ferkelfutter? Landwirtsch Wochenbl Rheinland 2001:34
Cited by
Sorted by citations
Microalgae for biodiesel production and other applications: A review
Mata, T. M., Martins, A. A., & Caetano, N. S. (2010) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2009.07.020 · Cited by 5,685
“Spirulina (Arthrospira) and Chlorella (a unicellular green microalga) are both considered edible algae that have been widely studied both in terms of their component molecules and their biological activities [40].”
InfluentialBrennan, L., & Owende, P. (2010) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2009.10.009 · Cited by 4,894
“Table 12 Potential of microalgae as primary PUFA resources [22] Please cite this article in press as: Brennan L, Owende P. Biofuels from microalgae—”
BackgroundInfluentialCommercial Applications of Microalgae
Spolaore, P., Joannis-Cassan, C., Duran, E., & Isambert, A. (2006) · Journal of Bioscience and Bioengineering · doi:10.1263/jbb.101.87 · Cited by 4,285
“25×10(9)/year (processed products not included in this figure) (10).”
Second Generation Biofuels: High-Efficiency Microalgae for Biodiesel Production
Schenk, P. M., Thomas‐Hall, S. R., Stephens, E., Marx, U. C., Mussgnug, J. H., Posten, C. H., Kruse, O., & Hankamer, B. D. (2008) · BioEnergy Research · doi:10.1007/s12155-008-9008-8 · Cited by 2,335
“Using highly efficient closed algal bioreactors for biomass feedstock and biomethane production, microalgae can now be grown in large amounts (150–300 tons per ha per year; [29, 138]).”
BackgroundKhan, M. I., Shin, J. H., & Kim, J. D. (2018) · Microbial Cell Factories · doi:10.1186/s12934-018-0879-x · Cited by 2,082
“The world energy crisis in the 1970s led to the identification of algae as renewable and sustainable sources for biofuels production, prompting the exploration of microalgae as a new field of research for fuels and other valuable products [10, 140].”
BackgroundAn outlook on microalgal biofuels
Wijffels, R. H., & Barbosa, M. J. (2010) · Science · doi:10.1126/science.1189003 · Cited by 1,886
Heterotrophic cultures of microalgae: Metabolism and potential products
Perez‐Garcia, O., Escalante, F. M. E., de‐Bashan, L. E., & Yoav Bashan, A. (2010) · Water Research · doi:10.1016/j.watres.2010.08.037 · Cited by 1,820
“Its strong antioxidant character makes it a nutraceutical product (food or nutritional supplement that may improve health) and may prevent some cancers (Hagen et al., 2001; Ma and Chen, 2001; Pulz and Gross, 2004; Del Rio et al., 2005; Ip and Chen, 2005a; Wang and Peng, 2008).”
BackgroundInfluentialHigh-value products from microalgae—their development and commercialisation
Borowitzka, M. A. (2013) · Journal of Applied Phycology · doi:10.1007/s10811-013-9983-9 · Cited by 1,585
“Products from algae have been reviewed recently in several papers (e.g. Pulz and Gross 2004; Spolaore et al. 2006), and this paper is not an exhaustive review of the range of existing and potential commercial high-value products from microalgae, but summarises existing products and proposed…”
BackgroundAlgae as nutritional and functional food sources: revisiting our understanding.
Wells, M. L., Potin, P., Craigie, J. S., Raven, J. A., Merchant, S. S., Helliwell, K. E., Smith, A. G., Camire, M. E., & Brawley, S. H. (2017) · Journal of Applied Phycology · doi:10.1007/s10811-016-0974-5 · Cited by 1,562
“…more than 60 years ago, and an impressive number of biological processes are now reported to be influenced by ingestion of whole algae or polysaccharide extracts as food or supplements (Pulz and Gross 2004; Plaza et al. 2009; Chacón-Lee and González-Mariño 2010; Lordan et al. 2011; Vo et al. 2011).”
Algal–bacterial processes for the treatment of hazardous contaminants: A review
Muñoz, R., & Guieysse, B. (2006) · Water Research · doi:10.1016/j.watres.2006.06.011 · Cited by 1,550
Lipid productivity as a key characteristic for choosing algal species for biodiesel production
Griffiths, M. J., & Harrison, S. T. L. (2009) · Journal of Applied Phycology · doi:10.1007/s10811-008-9392-7 · Cited by 1,421
“Pulz and Gross (2004) observed that: “successful algal biotechnology mainly depends on choosing the right alga with relevant properties for specific culture conditions and products”.”
BackgroundBiodiesel production from oleaginous microorganisms
Meng, X., Yang, J., Xu, X., Zhang, L., Nie, Q., & Xian, M. (2008) · Renewable Energy · doi:10.1016/j.renene.2008.04.014 · Cited by 1,155
Algal Proteins: Extraction, Application, and Challenges Concerning Production
Bleakley, S., & Hayes, M. (2017) · Foods · doi:10.3390/foods6050033 · Cited by 1,092
“This has led to the evolution of natural protective systems, such as the production of pigments (e.g., carotenes, chlorophylls, and phycobiliproteins) and polyphenols (e.g., catechins, flavonols, and phlorotannins), which can impart health benefits to the consumer when eaten [9,10].”
InfluentialMicroalgae as a sustainable energy source for biodiesel production: A review
Ahmad, A. L., Yasin, N. H. M., Derek, C. J. C., & Lim, J. K. (2011) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2010.09.018 · Cited by 1,063
“The first step is the selection of an appropriate species with the relevant properties for the specific culture conditions and products [92].”
BackgroundBioprocess engineering of microalgae to produce a variety of consumer products
Harun, R., Singh, M., Forde, G. M., & Danquah, M. K. (2009) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2009.11.004 · Cited by 1,044
Biodiesel from microalgae: A critical evaluation from laboratory to large scale production
Rawat, I., Ranjith Kumar, R., Mutanda, T., & Bux, F. (2013) · Applied Energy · doi:10.1016/j.apenergy.2012.10.004 · Cited by 977
“Photobioreactors are closed systems enabling mono-specific microalgal cultivation while open raceway ponds are open system [86,87].”
BackgroundMicroalgae: A potential alternative to health supplementation for humans
Koyande, A. K., Chew, K. W., Rambabu, K., Tao, Y., Chu, D.-T., & Show, P.-L. (2019) · Food Science and Human Wellness · doi:10.1016/j.fshw.2019.03.001 · Cited by 908
Microalgae Metabolites: A Rich Source for Food and Medicine
Sathasivam, R., Radhakrishnan, R., Hashem, A., & Abd_Allah, E. F. (2019) · Saudi Journal of Biological Sciences · doi:10.1016/j.sjbs.2017.11.003 · Cited by 872
“Currently, most of the commercialized products of microalgae are available in markets as a health food, in the forms of tablets, capsules and liquids (Pulz and Gross, 2004), and their products are mixed with pastes, snacks, candy, gums, noodles, wine, beverages, and breakfast cereals (Yamaguchi, 1997; Lee, 1997; Liang…”
BackgroundDesign principles of photo-bioreactors for cultivation of microalgae
Posten, C. (2009) · Engineering in Life Sciences · doi:10.1002/elsc.200900003 · Cited by 815
“In a study [74] Pulz claims very high productivities for this reactor, of a mean of 98 g/m2/d. Peak values are given Lime tree Idea after Pulz AG = 100 m2 AR = 2.500 m2 (leaves) Parenchyma of a leaf Light CO2 H2O, O2 Figure 12.”
BackgroundInfluentialBiofuels from algae: Challenges and potential
Hannon, M., Gimpel, J., Tran, M., Rasala, B., & Mayfield, S. (2010) · Biofuels · doi:10.4155/bfs.10.44 · Cited by 813
“For further reading see [183,188–192].”
Markou, G., & Nerantzis, E. (2013) · Biotechnology Advances · doi:10.1016/j.biotechadv.2013.07.011 · Cited by 815
Suganya, T., Varman, M., Masjuki, H. H., & Renganathan, S. (2016) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2015.11.026 · Cited by 793
Outdoor cultivation of microalgae for carotenoid production: Current state and perspectives
Del Campo, J. A., García-González, M., & Guerrero, M. G. (2007) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-007-0844-9 · Cited by 739
“Global production of Dunaliella is estimated at about 1,200 t year (Pulz and Gross 2004).”
BackgroundInfluentialProduction cost of a real microalgae production plant and strategies to reduce it
Acién, F. G., Fernández, J. M., Magán, J. J., & Molina, E. (2012) · Biotechnology Advances · doi:10.1016/j.biotechadv.2012.02.005 · Cited by 735
Kumar, A., Ergas, S. J., Yuan, X., Sahu, A., Zhang, Q., Dewulf, J. P., Malcata, F. X., & Langenhove, H. R. V. (2010) · Trends in biotechnology · doi:10.1016/j.tibtech.2010.04.004 · Cited by 752
Production of phycocyanin—a pigment with applications in biology, biotechnology, foods and medicine
Eriksen, N. T. (2008) · Applied Microbiology and Biotechnology · doi:10.1007/s00253-008-1542-y · Cited by 714
Marine Polysaccharides from Algae with Potential Biomedical Applications
Raposo, M. F. D. J., Morais, A. M. M. B., & Morais, R. M. S. C. (2015) · Marine Drugs · doi:10.3390/md13052967 · Cited by 712
“However, comparatively, there are only a handful of research papers on microalgae [9–14], despite the richness of their composition and the ability to make them grow.”
BackgroundCarbon Dioxide Recycling: Emerging Large‐Scale Technologies with Industrial Potential
Quadrelli, E. A., Centi, G., Duplan, J., & Perathoner, S. (2011) · ChemSusChem · doi:10.1002/cssc.201100473 · Cited by 664
Microalgae as sources of carotenoids
Guedes, A. C., Amaro, H. M., & Malcata, F. X. (2011) · Marine Drugs · doi:10.3390/md9040625 · Cited by 639
“—all of which belong to the Chlorophyceae family [2].”
Microalgae as versatile cellular factories for valued products
Koller, M., Muhr, A., & Braunegg, G. (2014) · Algal Research · doi:10.1016/j.algal.2014.09.002 · Cited by 639
A green light for engineered algae: redirecting metabolism to fuel a biotechnology revolution
Rosenberg, J. N., Oyler, G. A., Wilkinson, L., & Betenbaugh, M. J. (2008) · Current Opinion in Biotechnology · doi:10.1016/j.copbio.2008.07.008 · Cited by 631
“The worldwide annual production of algal biomass is estimated to be 5 million kilograms per year with a market value of about 330 USD per kilogram [17].”
BackgroundPower to Gas projects review: Lab, pilot and demo plants for storing renewable energy and CO2
Bailera, M., Lisbona, P., Romeo, L. M., & Espatolero, S. (2016) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2016.11.130 · Cited by 656
“commercially applied in other non-energetic uses as pharmaceuticals [19][20],”
BackgroundStengel, D. B., Connan, S., & Popper, Z. A. (2011) · Biotechnology Advances · doi:10.1016/j.biotechadv.2011.05.016 · Cited by 640
The promise and challenges of microalgal‐derived biofuels
Pienkos, P. T., & Darzins, A. (2009) · Biofuels, Bioproducts and Biorefining · doi:10.1002/bbb.159 · Cited by 602
Bioactivity and applications of sulphated polysaccharides from marine microalgae
Raposo, M., De Morais, R., & Bernardo de Morais, A. (2013) · Marine Drugs · doi:10.3390/md11010233 · Cited by 594
“larvae (aquaculture) [7]”
InfluentialAntioxidant potential of microalgae in relation to their phenolic and carotenoid content
Goiris, K., Muylaert, K., Fraeye, I., Foubert, I., Brabanter, J. D., & Cooman, L. D. (2012) · Journal of Applied Phycology · doi:10.1007/s10811-012-9804-6 · Cited by 590
“Haematococcus for astaxanthin, Dunaliella for βcarotene) for use as additives in food and feed applications, as well as for use in cosmetics and as food supplements (Pulz and Gross 2004; Spolaore et al. 2006).”
BackgroundPerspectives on Microalgal CO2-Emission Mitigation Systems—A Review
Ho, S.-H., Chen, C.-Y., Lee, D.-J., & Chang, J.-S. (2011) · Biotechnology Advances · doi:10.1016/j.biotechadv.2010.11.001 · Cited by 580
“…and amine coating activated carbon (Plaza et al., 2007) and others; (2) direct injection to underground (Herzog, 2001) or to the ocean (Israelsson et al., 2009); and (3) biological CO2 mitigation, with CO2 being biologically converted to organic matters (Pulz and Gross, 2004; Skjanes et al., 2007).”
Exploring the potential of microalgae for new biotechnology applications and beyond: a review
Rizwan, M., Mujtaba, G., Memon, S. A., Lee, K., & Rashid, N. (2018) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2018.04.034 · Cited by 578
Algae as Production Systems of Bioactive Compounds
Michalak, I., & Chojnacka, K. (2015) · Engineering in Life Sciences · doi:10.1002/elsc.201400191 · Cited by 576
“Algae may constitute a valuable source of a new class of biological plant-protecting substances [23].”
BackgroundInfluentialMicroalgae as a future food source
Torres-Tiji, Y., Fields, F. J., & Mayfield, S. P. (2020) · Biotechnology Advances · doi:10.1016/j.biotechadv.2020.107536 · Cited by 559
A review of high value-added molecules production by microalgae in light of the classification
Levasseur, W., Perré, P., & Pozzobon, V. (2020) · Biotechnology Advances · doi:10.1016/j.biotechadv.2020.107545 · Cited by 575
Spirulina – From growth to nutritional product: A review
Soni, R. A., Sudhakar, K., & Rana, R. S. (2017) · Trends in Food Science & Technology · doi:10.1016/j.tifs.2017.09.010 · Cited by 528
Vitamin B 12 Sources and Bioavailability
Watanabe, F. (2007) · Experimental Biology and Medicine · doi:10.3181/0703-mr-67 · Cited by 519
“Some species of the cyanobacteria, including Spirulina, Aphanizomenon, and Nostoc, are produced at annual rates of 500-3000 tons for food and pharmaceutical industries worldwide (61).”
BackgroundMicroalgae for the production of bulk chemicals and biofuels
Wijffels, R. H., Barbosa, M. J., & Eppink, M. H. M. (2010) · Biofuels, Bioproducts and Biorefining · doi:10.1002/bbb.215 · Cited by 522
Cuellar‐Bermudez, S. P., Aguilar‐Hernandez, I., Cardenas‐Chavez, D. L., Ornelas‐Soto, N., Romero‐Ogawa, M. A., & Parra‐Saldivar, R. (2015) · Microbial Biotechnology · doi:10.1111/1751-7915.12167 · Cited by 486
“In addition, ARA and DHA are required for normal growth and brain functional development, while EPA is essential for the regulation of some biological functions and prevention of arrhythmia, atherosclerosis, cardiovascular disease and cancer (Pulz and Gross, 2004).”
BackgroundInfluentialRapid quantification of microalgal lipids in aqueous medium by a simple colorimetric method
Mishra, S. K., Suh, W. I., Farooq, W., Moon, M., Shrivastav, A., Park, M. S., & Yang, J.-W. (2014) · Bioresource Technology · doi:10.1016/j.biortech.2013.12.077 · Cited by 487
Potentials of macroalgae as feedstocks for biorefinery
Jung, K. A., Lim, S.-R., Kim, Y., & Park, J. M. (2013) · Bioresource Technology · doi:10.1016/j.biortech.2012.10.025 · Cited by 487
National Algal Biofuels Technology Roadmap
USDOE Office of Energy Efficiency and Renewable Energy (EERE), O. O. S. T. B. T. O. (., Ferrell, J., & Sarisky-Reed, V. (2010) · OSTI OAI (U.S. Department of Energy Office of Scientific and Technical Information) · doi:10.2172/1218560 · Cited by 470
Interference by Pigment in the Estimation of Microalgal Biomass Concentration by Optical Density
Griffiths, M. J., Garcin, C., van Hille, R. P., & Harrison, S. T. L. (2011) · Journal of Microbiological Methods · doi:10.1016/j.mimet.2011.02.005 · Cited by 463
An overview: biomolecules from microalgae for animal feed and aquaculture
Yaakob, Z., Ali, E., Zainal, A., Mohamad, M., & Takriff, M. S. (2014) · Journal of Biological Research - Thessaloniki · doi:10.1186/2241-5793-21-6 · Cited by 488
“Algae is a rich source of high quality protein, vitamins, micronutrients (trace elements), and carotenoids, Long-chain PUFAs, especially of n-3 and n-6 series such as eicosapentaenoic (EPA), docosahexaenoic (DHA), and arachidonic (AA) are considered pharmacologically important for dietetics and therapeutics [90].”
Carotenoids from Marine Organisms: Biological Functions and Industrial Applications
Galasso, C., Corinaldesi, C., & Sansone, C. (2017) · Antioxidants · doi:10.3390/antiox6040096 · Cited by 442
“, is characterized by microalgae with the widest diversity of pigments [121].”
BackgroundMicroalgae for “Healthy” Foods-Possibilities and Challenges
Chacón‐Lee, T. L., & González‐Mariño, G. E. (2010) · Comprehensive Reviews in Food Science and Food Safety · doi:10.1111/j.1541-4337.2010.00132.x · Cited by 428
High-efficiency homologous recombination in the oil-producing alga Nannochloropsis sp.
Kilian, O., Benemann, C. S. E., Niyogi, K., & Vick, B. (2011) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.1105861108 · Cited by 421
“Many algae have high photoautotrophic growth rates and can accumulate more than half their dry weight biomass as lipids (5), including triacylglycerol and a number of high-value pharmaceutical and nutraceutical products (6).”
BackgroundTibbetts, S. M., Milley, J. E., & Lall, S. P. (2014) · Journal of Applied Phycology · doi:10.1007/s10811-014-0428-x · Cited by 423
“and aquaculture sectors appear to be the most promising areas to focus for generating revenues (Pulz and Gross 2004; Brune et al. 2009; Stephens et al. 2010; Subhadra and Grinson 2011; Ahmed et al. 2012).”
BackgroundInfluentialA Potential Commercial Source of Fucoxanthin Extracted from the Microalga Phaeodactylum tricornutum
Kim, S. M., Jung, Y.-J., Kwon, O.-N., Cha, K. H., Um, B.-H., Chung, D., & Pan, C.-H. (2012) · Applied Biochemistry and Biotechnology · doi:10.1007/s12010-012-9602-2 · Cited by 417
Huerlimann, R., de Nys, R., & Heimann, K. (2010) · Biotechnology and Bioengineering · doi:10.1002/bit.22809 · Cited by 413
“2010 Wiley Periodicals, Inc. (Natrah et al., 2007; Plaza et al., 2008), animal feeds and fertilizers (reviewed in Pulz and Gross, 2004; Spolaore et al., 2006), and bioplastics (Murphy, 2006).”
BackgroundHealth applications of bioactive compounds from marine microalgae
Raposo, M. F. D. J., Morais, R. M. S. C., & Morais, A. M. M. B. (2013) · Life Sciences · doi:10.1016/j.lfs.2013.08.002 · Cited by 426
A perspective on the biotechnological potential of microalgae
Raja, R., Hemaiswarya, S., Kumar, N. A., Sridhar, S., & Rengasamy, R. (2008) · Critical Reviews in Microbiology · doi:10.1080/10408410802086783 · Cited by 404
Potential of industrial biotechnology with cyanobacteria and eukaryotic microalgae
Wijffels, R. H., Kruse, O., & Hellingwerf, K. J. (2013) · Current Opinion in Biotechnology · doi:10.1016/j.copbio.2013.04.004 · Cited by 404
“Food supplements from microalgae comprise an important market in which compounds such as b-carotene, astaxanthin, polyunsaturated fatty acid (PUFA) such as DHA and EPA and polysaccharides such as beta-glucan dominate [1,2].”
BackgroundXia, S., Wang, K., Wan, L., Li, A., Hu, Q., & Zhang, C. (2013) · Marine Drugs · doi:10.3390/md11072667 · Cited by 408
“[8].”
Enamala, M. K., Enamala, S., Chavali, M. S., Jagadish, D., Yadavalli, R., Kolapalli, B., Aradhyula, T. V., Velpuri, J., & Chandrasekhar, K. (2018) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2018.05.012 · Cited by 400
Fabris, M., Abbriano, R. M., Pernice, M., Sutherland, D. L., Commault, A. S., Hall, C. C., Labeeuw, L., McCauley, J. I., Kuzhiuparambil, U., Ray, P., et al. (2020) · Frontiers in Plant Science · doi:10.3389/fpls.2020.00279 · Cited by 382
Schmollinger, S., Mühlhaus, T., Boyle, N. R., Blaby, I. K., Casero, D., Mettler, T., Moseley, J. L., Kropat, J., Sommer, F., Strenkert, D., et al. (2014) · The Plant Cell · doi:10.1105/tpc.113.122523 · Cited by 369
“…potential in the production of biofuels (H2, ethanol, or biodiesel) and high-value products like carotenoids, fatty acids, or recombinant proteins (Pulz and Gross, 2004; Chisti, 2007; Wijffels and Barbosa, 2010; Georgianna and Mayfield, 2012; Jones and Mayfield, 2012; Merchant et al., 2012), and…”
BackgroundVitamin B12 among Vegetarians: Status, Assessment and Supplementation
Rizzo, G., Laganà, A., Rapisarda, A., La Ferrera, G., Buscema, M., Rossetti, P., Nigro, A., Muscia, V., Valenti, G., Sapia, F., et al. (2016) · Nutrients · doi:10.3390/nu8120767 · Cited by 372
“Chlorella pyrenoidosa is a microalgae frequently used as a supplement [187].”
BackgroundEngineering photosynthetic light capture: impacts on improved solar energy to biomass conversion
Mussgnug, J. H., Thomas‐Hall, S. R., Rupprecht, J., Foo, A., Классен, В., McDowall, A. W., Schenk, P. M., Kruse, O., & Hankamer, B. D. (2007) · Plant Biotechnology Journal · doi:10.1111/j.1467-7652.2007.00285.x · Cited by 373
“The selected sequence (corresponding to nucleotides 527–713 3′ from the cDNA start codon) was amplified by PCR using LHCBM1 cDNA as template (sense primers: cggaattcgcctggacaagctgtaccc-gctctagaaggtggtcggacaggttc, antisense primers: cggaattcgcctggacaagctgtaccc-gctctagaaccagaccacacaagacgac, XbaI and EcoRI restriction si…”
MethodInfluentialNet energy and greenhouse gas emission evaluation of biodiesel derived from microalgae
Batan, L., Quinn, J., Willson, B., & Bradley, T. (2010) · Environmental Science & Technology · doi:10.1021/es102052y · Cited by 360
Pereira, H., Barreira, L. A., Figueiredo, F., Custódio, L. M. B., Vizetto‐Duarte, C., Polo, C., Rešek, E., Engelen, A. H., & Varela, J. C. S. (2012) · Marine Drugs · doi:10.3390/md10091920 · Cited by 371
“Considering their fundamental role in metabolism, it comes as no surprise that beneficial properties have been attributed to PUFA, like antibacterial [4–6], anti-inflammatory [7,8], antioxidant [9], prevention of cardiac diseases [10], and inhibition of tumor progression [11,12].”
BackgroundMicroalgae cultivation in photobioreactors: sustainable solutions for a greener future
Abdur Razzak, S., Bahar, K., Islam, K. M. O., Haniffa, A. K., Faruque, M. O., Hossain, S. M. Z., & Hossain, M. M. (2024) · Green Chemical Engineering · doi:10.1016/j.gce.2023.10.004 · Cited by 366
Kwietniewska, E., & Tys, J. (2014) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2014.03.041 · Cited by 354
Skjånes, K., Rebours, C., & Lindblad, P. (2013) · Critical Reviews in Biotechnology · doi:10.3109/07388551.2012.681625 · Cited by 352
“, dominated by Chlorella vulgaris, is widely used as human health food due to its high nutritional value (Pulz and Gross, 2004), and the majority of Chlorella biomass for human consumption has been sold as tablets or capsules.”
BackgroundScenedesmus obliquus CNW-N as a potential candidate for CO2 mitigation and biodiesel production
Ho, S.-H., Chen, W.-M., & Chang, J.-S. (2010) · Bioresource Technology · doi:10.1016/j.biortech.2010.06.112 · Cited by 350
“products, and so on (Pulz and Gross, 2004), representing additional benefits from the microalgal CO2 reduction process (de Morais and Costa, 2007b).”
BackgroundFood and feed products from micro-algae: Market opportunities and challenges for the EU
Vigani, M., Parisi, C., Rodríguez-Cerezo, E., Barbosa, M. J., Sijtsma, L., Ploeg, M., & Enzing, C. (2015) · Trends in Food Science & Technology · doi:10.1016/j.tifs.2014.12.004 · Cited by 350
Thermochemical Conversion of Microalgal Biomass for Biofuel Production
Raheem, A., Wan Azlina, W. A. K. G., Taufiq Yap, Y. H., Danquah, M. K., & Harun, R. (2015) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2015.04.186 · Cited by 349
Dunaliella biotechnology: methods and applications
Hosseini Tafreshi, A., & Shariati, M. (2009) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2009.04153.x · Cited by 343
“1986; Moulton and Burford 1990) and the flesh and shell of aquatic animals, such as prawns and ornamental fishes, to make them more attractive in the market (Pulz and Gross 2004).”
BackgroundGriffiths, M. J., van Hille, R. P., & Harrison, S. T. L. (2012) · Journal of Applied Phycology · doi:10.1007/s10811-011-9723-y · Cited by 341
Future prospects of microalgal biofuel production systems
Stephens, E., Ross, I. L., Mussgnug, J. H., Wagner, L. D., Borowitzka, M. A., Posten, C., Kruse, O., & Hankamer, B. (2010) · Trends in Plant Science · doi:10.1016/j.tplants.2010.06.003 · Cited by 340
Microalgae as Sources of High-Quality Protein for Human Food and Protein Supplements
Wang, Y., Tibbetts, S. M., & McGinn, P. J. (2021) · Foods · doi:10.3390/foods10123002 · Cited by 360
Cuéllar‐Bermúdez, S. P., García‐Pérez, J. S., Rittmann, B. E., & Parra‐Saldívar, R. (2014) · Journal of Cleaner Production · doi:10.1016/j.jclepro.2014.03.034 · Cited by 335
“Different studies have shown that EPA (20:5) is essential for the regulation of some biological functions as prevention factor of arrhythmia, atherosclerosis, cardiovascular diseases and cancer (Pulz and Gross, 2004).”
Kusmayadi, A., Leong, Y. K., Yen, H., Huang, C.-Y., & Chang, J. (2021) · Chemosphere · doi:10.1016/j.chemosphere.2021.129800 · Cited by 348
Catalytic deoxygenation of microalgae oil to green hydrocarbons
Zhao, C., Brück, T., & Lercher, J. A. (2013) · Green Chemistry · doi:10.1039/c3gc40558c · Cited by 333
Marine Carotenoids: Biological Functions and Commercial Applications
Vílchez, C., Forján, E., Cuaresma, M., Bédmar, F., Garbayo, I., & Vega, J. M. (2011) · Marine Drugs · doi:10.3390/md9030319 · Cited by 328
Liu, J., Sun, Z., Gerken, H. G., Liu, Z., Jiang, Y., & Chen, F. (2014) · Marine Drugs · doi:10.3390/md12063487 · Cited by 323
“Microalgae are sunlight-driven cell factories that are able to efficiently utilize carbon dioxide for the production of numerous products such as proteins, polysaccharides, oils, vitamins, carotenoids and other biologically active compounds, and are therefore used in a wide variety of technological applications for th…”
BackgroundAlgal biofilm based technology for wastewater treatment
Kesaano, M., & Sims, R. C. (2014) · Algal Research · doi:10.1016/j.algal.2014.02.003 · Cited by 323
Olivier Bernard, A. (2011) · Journal of Process Control · doi:10.1016/j.jprocont.2011.07.012 · Cited by 320
“Indeed, there is a wide diversity of innovative applications ranging from pigments, antioxidants, vitamins, proteins, cosmetics, fish food, to CO2 capture and bioenergy (Pulz and Gross, 2004; Spolaore et al., 2006).”
BackgroundUdaiyappan, A. F. M., Hasan, H. A., Takriff, M. S., & Abdullah, S. R. S. (2017) · Journal of Water Process Engineering · doi:10.1016/j.jwpe.2017.09.006 · Cited by 336
Microalgae as a new source of bioactive compounds in food supplements
Vaz, B. D. S., Moreira, J. B., de Morais, M. G., & Costa, J. A. V. (2016) · Current Opinion in Food Science · doi:10.1016/j.cofs.2015.12.006 · Cited by 328
Salehi, B., Sharifi‐Rad, J., Seca, A. M. L., Pinto, D. C. G. A., Michalak, I., Trincone, A., Mishra, A. P., Nigam, M., Zam, W., & Martins, N. A. (2019) · Molecules · doi:10.3390/molecules24224182 · Cited by 324
“Glyco- and phospholipids have applications in cosmetic and beauty products as studied for microalgae originating components of this type [349]; similar compounds from macroalgae could be advantageous and should not be neglected.”
BackgroundTrends and novel strategies for enhancing lipid accumulation and quality in microalgae
Singh, P., Kumari, S., Guldhe, A., Misra, R., Rawat, I., & Bux, F. (2016) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2015.11.001 · Cited by 309
Microalgae: a promising tool for carbon sequestration
Singh, U. B., & Ahluwalia, A. S. (2012) · Mitigation and Adaptation Strategies for Global Change · doi:10.1007/s11027-012-9393-3 · Cited by 311
“…α-Tocopherol High Pharmaceutical and nutritional industry (Borowitzka 1992; Apt and Behrens 1999; Kusmic et al. 1999; Grima et al. 2003; Becker 2004; Pulz and Gross 2004; Singh et al. 2005; Thajuddin and Subramanian 2005; Spolaore et al. 2006; Del Campo et al. 2007; Wijffels 2007; Raja et al.…”
BackgroundBitog, J. P., Lee, I. B., Lee, C., Kim, K. S., Hwang, H.-S., Hong, S.-W., Seo, I.-H., Kwon, K.-S., & Mostafa, E. (2011) · Computers and Electronics in Agriculture · doi:10.1016/j.compag.2011.01.015 · Cited by 316
Microalgae: a novel ingredient in nutrition
Christaki, E. V., Florou-Paneri, P. C., & Bonos, E. (2011) · International Journal of Food Sciences and Nutrition · doi:10.3109/09637486.2011.582460 · Cited by 298
“They are used mainly as dietary supplements in the health food market, in the form of powder, capsule, pastille or tablet (Pulz and Gross 2004; Christaki et al. 2010).”
BackgroundInfluentialAlgal extracts: Technology and advances
Michalak, I., & Chojnacka, K. (2014) · Engineering in Life Sciences · doi:10.1002/elsc.201400139 · Cited by 289
“Abbreviations: DHA, docosahexaenoic acid; EAE, enzyme-assisted extraction; MAE, microwave-assisted extraction; PLE, pressurized liquid extraction; PUFA, polyunsaturated fatty acid; SFE, supercritical fluid extraction; UAE, ultrasound-assisted extraction According to the literature data, the total weight of dry biomass…”
BackgroundMethodRecent Developments in Production and Biotechnological Applications of C-Phycocyanin
Kuddus, M., Singh, P., Thomas, G., & Al-Hazimi, A. (2013) · BioMed Research International · doi:10.1155/2013/742859 · Cited by 286
“platensis dry weight (>3000 metric ton) that are produced worldwide annually are used for health products and animal feed additives [62, 63].”
BackgroundFlow cytometry for the development of biotechnological processes with microalgae
Hyka, P., Lickova, S., Přibyl, P., Melzoch, K., & Kovar, K. (2012) · Biotechnology Advances · doi:10.1016/j.biotechadv.2012.04.007 · Cited by 282
“, 2011) give the size of the microalgal biomass market worldwide as being about 5000 t year−1 of dry matter (Pulz and Gross, 2004) and generating a turnover of ca.”
BackgroundInfluentialCarbon sequestration and the role of biological carbon mitigation: A review
Farrelly, D. J., Everard, C. D., Fagan, C. C., & McDonnell, K. P. (2013) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2012.12.038 · Cited by 294
Electroporation in Food Processing and Biorefinery
Mahnič-Kalamiza, S., Vorobiev, E., & Miklavčič, D. (2014) · The Journal of Membrane Biology · doi:10.1007/s00232-014-9737-x · Cited by 300
“…source of energy (Hannon et al. 2010), food (Draaisma et al. 2013), feed (Skrede et al. 2011; Kiron et al. 2012), cosmetics and pharmaceuticals (Pulz and Gross 2004; Gong and Jiang 2011), owing to their high photosynthetic efficiency, higher biomass production and faster growth compared to…”
BackgroundMini-review: Inhibition of biofouling by marine microorganisms
Dobretsov, S., Abed, R. M. M., & Teplitski, M. (2013) · Biofouling · doi:10.1080/08927014.2013.776042 · Cited by 283
“Therefore, marine cyanobacteria have been recognised as a rich source of secondary metabolites with AF properties (Burja et al. 2001; Pulz & Gross 2004; Abed et al. 2009; Dobretsov et al. 2010; Kwan et al. 2011).”
The Evolution and Versatility of Microalgal Biotechnology: A Review
Hamed, I. (2016) · Comprehensive Reviews in Food Science and Food Safety · doi:10.1111/1541-4337.12227 · Cited by 302
Arbib, Z., Ruiz, J., Álvarez, P., Garrido-Pérez, C., & Perales, J. A. (2013) · Water Research · doi:10.1016/j.watres.2013.10.036 · Cited by 281
“The organic matter produced by photosynthetic microalgae and cyanobacteria can be transformed into a wide range valuable products, such as pharmaceuticals, food additives and other health-care products (Pulz and Gross, 2004).”
BackgroundFactors Affecting Algae Biofilm Growth and Lipid Production: A Review
Schnurr, P. J., & Allen, D. G. (2015) · Renewable and Sustainable Energy Reviews · doi:10.1016/j.rser.2015.07.090 · Cited by 276
Metadata
- Authors
- Pulz, O., & Gross, W.
- Affiliations
- Institut für Getreideverarbeitung (Germany) (DE)
- Freie Universität Berlin (DE)
- Corresponding author
- Pulz, Otto
- Venue
- Applied Microbiology and Biotechnology
- Published
- 2004-08-06
- Volume
- 65
- Issue
- 6
- Pages
- 635-648
- ISSN
- 0175-7598 (ISSN-L)
- 1432-0614
- OpenAlex
- W2044809902
- Cited by
- 2,132
- References
- 40
- Citations by year
- 2026: 56 · 2025: 82 · 2024: 119 · 2023: 104 · 2022: 109 · 2021: 150 · 2020: 169 · 2019: 152 · 2018: 124 · 2017: 127 · 2016: 134 · 2015: 162 · 2014: 152 · 2013: 132 · 2012: 107
- FWCI
- 2.57
- Type
- journal article
- Language
- en
- Open access
- closed
- Licence
- www.springer.com/tdm (tdm)
- Locations
- Applied Microbiology and Biotechnology (publishedVersion)
- PubMed (publishedVersion)
- Topics
- Physical Sciences › Energy › Renewable Energy, Sustainability and the Environment › Algal biology and biofuel production
- Life Sciences › Agricultural and Biological Sciences › Aquatic Science › Seaweed-derived Bioactive Compounds
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Microbial Metabolic Engineering and Bioproduction
- Keywords
- microalgae, microalgal biotechnology, microalgal biomass, food and feed, genetic engineering of microalgae, pharmaceutical applications, ecological applications, screening method
- MeSH terms
- Biotechnology, Drug Industry, Food Industry, Eukaryota
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
