Cited by 36,648Banana Cultivation and ResearchPlant Pathogens and Fungal DiseasesYeasts and Rust Fungi Studies

The DOI matches its Crossref record.

AMPLIFICATION AND DIRECT SEQUENCING OF FUNGAL RIBOSOMAL RNA GENES FOR PHYLOGENETICS

White, T.J., Bruns, T., Lee, S., Taylor, J.·1990·PCR Protocols

DOI 10.1016/b978-0-12-372180-8.50042-1

Open this paper in CoChat — free account

Integrity signals

Registry

Crossref · 10.1016/b978-0-12-372180-8.50042-1

Cites

Statistics

Recomputing p-values needs the paper’s full text.

Claims the paper makes

We couldn’t retrieve this paper’s full text, so its claims and self-check weren’t run. The registry and citation checks still apply.

No references could be resolved yet.

Research works printed but not linked: 9

Bruns, 1989, Evolution of mushroom mitochondrial DNA: Suillus and related genera, J. Mol. Evol., 28, 349, 10.1007/BF02103431 · DOI
Dams, 1988, Compilation of small ribosomal subunit RNA sequences, Nucleic Acids Res., 16, r87, 10.1093/nar/16.suppl.r87 · DOI
Hamby, 1989, Direct ribosomal RNA sequencing: optimization of extraction and sequencing methods for work with higher plants, Plant Mol. Biol. Rep., 6, 175, 10.1007/BF02669591 · DOI
Jorgensen, 1989, Modes and tempos in the evolution of nuclear ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies, Ann. Mo. Bot. Gard., 75, 1238, 10.2307/2399282 · DOI
Kelly, 1982, The nucleotide sequence at the 3′-end of Neurospora crassa 18S-rRNA and studies on the interaction with 5S-rRNA, Nucleic Acids Res., 10, 6733, 10.1093/nar/10.21.6733 · DOI
Lane, 1985, Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses, Proc. Natl Acad. Sci. USA, 82, 6955, 10.1073/pnas.82.20.6955 · DOI
Medlin, 1988, The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions, Gene, 71, 491, 10.1016/0378-1119(88)90066-2 · DOI
Meinkoth, 1984, Hybridization of nucleic acids immobilized on solid supports, Anal. Biochem., 138, 267, 10.1016/0003-2697(84)90808-X · DOI
Woese, 1986, Archaebacterial phylogeny: perspectives on the urkingdoms, Syst. Appl. Microbiol., 7, 161, 10.1016/S0723-2020(86)80001-7 · DOI

Sorted by citations

Diet rapidly and reproducibly alters the human gut microbiome
David, L. A., Maurice, C. F., Carmody, R. N., Gootenberg, D. B., Button, J. E., Wolfe, B. E., Ling, A. V., Devlin, A. S., Varma, Y., Fischbach, M. A., et al. (2014) · Nature · doi:10.1038/nature12820 · Cited by 10,100
Development of the Human Infant Intestinal Microbiota
Palmer, C., Bik, E. M., DiGiulio, D. B., Relman, D. A., & Brown, P. O. (2007) · PLoS Biology · doi:10.1371/journal.pbio.0050177 · Cited by 2,877
The Colletotrichum gloeosporioides species complex
Weir, B. S., Johnston, P. R., & Damm, U. (2012) · Studies in Mycology · doi:10.3114/sim0011 · Cited by 1,646
Candida auris sp. nov., a novel ascomycetous yeast isolated from the external ear canal of an inpatient in a Japanese hospital
Satoh, K., Makimura, K., Hasumi, Y., Nishiyama, Y., Uchida, K., & Yamaguchi, H. (2009) · Microbiology and Immunology · doi:10.1111/j.1348-0421.2008.00083.x · Cited by 1,381
Cheese rind communities provide tractable systems for in situ and in vitro studies of microbial diversity
Wolfe, B. E., Button, J. E., Santarelli, M., & Dutton, R. J. (2014) · Cell · doi:10.1016/j.cell.2014.05.041 · Cited by 648
Pan-cancer analyses reveal cancer-type-specific fungal ecologies and bacteriome interactions
Narunsky-Haziza, L., Sepich-Poore, G. D., Livyatan, I., Asraf, O., Martino, C., Nejman, D., Gavert, N., Stajich, J. E., Amit, G., González, A., et al. (2022) · Cell · doi:10.1016/j.cell.2022.09.005 · Cited by 538
Comprehensive Diagnostic Strategy for Blood Culture–Negative Endocarditis: A Prospective Study of 819 New Cases
Fournier, P., Thuny, F., Richet, H., Lepidi, H., Casalta, J., Arzouni, J., Maurin, M., Célard, M., Mainardi, J., Caus, T., et al. (2010) · Clinical Infectious Diseases · doi:10.1086/653675 · Cited by 506
Multidrug-resistant endemic clonal strain of Candida auris in India
Chowdhary, A., Anil Kumar, V., Sharma, C., Prakash, A., Agarwal, K., Babu, R., Dinesh, K. R., Karim, S., Singh, S. K., Hagen, F., et al. (2014) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-013-2027-1 · Cited by 373
Characterization and pathogenicity of Colletotrichum species associated with anthracnose on chilli ( Capsicum spp.) in Thailand
Than, P. P., Jeewon, R., Hyde, K. D., Pongsupasamit, S., Mongkolporn, O., & Taylor, P. W. J. (2008) · Plant Pathology · doi:10.1111/j.1365-3059.2007.01782.x · Cited by 386
Necrotizing Cutaneous Mucormycosis after a Tornado in Joplin, Missouri, in 2011
Neblett Fanfair, R., Benedict, K., Bos, J., Bennett, S. D., Lo, Y.-C., Adebanjo, T., Etienne, K., Deak, E., Derado, G., Shieh, W.-J., et al. (2012) · New England Journal of Medicine · doi:10.1056/nejmoa1204781 · Cited by 360
Effect of Candida glabrata FKS1 and FKS2 Mutations on Echinocandin Sensitivity and Kinetics of 1,3-β- d -Glucan Synthase: Implication for the Existing Susceptibility Breakpoint
Garcia-Effron, G., Lee, S., Park, S., Cleary, J. D., & Perlin, D. S. (2009) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00443-09 · Cited by 323
Self-citation
Ecological network analysis reveals the inter-connection between soil biodiversity and ecosystem function as affected by land use across Europe
Creamer, R. E., Hannula, S. E., Leeuwen, J. P. V., Stone, D., Rutgers, M., Schmelz, R. M., Ruiter, P. C. D., Hendriksen, N. B., Bolger, T., Bouffaud, M. L., et al. (2016) · Applied Soil Ecology · doi:10.1016/j.apsoil.2015.08.006 · Cited by 275
Increased yield and CO 2 sequestration potential with the C 4 cereal Sorghum bicolor cultivated in basaltic rock dust‐amended agricultural soil
Kelland, M. E., Wade, P. W., Lewis, A. L., Taylor, L. L., Sarkar, B., Andrews, M. G., Lomas, M. R., Cotton, T. E. A., Kemp, S. J., James, R. H., et al. (2020) · Global Change Biology · doi:10.1111/gcb.15089 · Cited by 281
Population-Based Survey of Filamentous Fungi and Antifungal Resistance in Spain (FILPOP Study)
Alastruey-Izquierdo, A., Mellado, E., Peláez, T., Pemán, J., Zapico, S., Alvarez, M., Rodríguez-Tudela, J. L., Cuenca-Estrella, M., & FILPOP Study Group (2013) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00383-13 · Cited by 276
Candida auris–Associated Candidemia, South Africa
Magobo, R. E., Corcoran, C., Seetharam, S., & Govender, N. P. (2014) · Emerging Infectious Diseases · doi:10.3201/eid2007.131765 · Cited by 259
Candida colonisation as a source for candidaemia
Miranda, L. N., van der Heijden, I. M., Costa, S. F., Sousa, A. P. I., Sienra, R. A., Gobara, S., Santos, C. R., Lobo, R. D., Pessoa, V. P., & Levin, A. S. (2009) · Journal of Hospital Infection · doi:10.1016/j.jhin.2009.02.009 · Cited by 250
Evolution of the fungal self-fertile reproductive life style from self-sterile ancestors
Yun, S.-H., Berbee, M. L., Yoder, O. C., & Turgeon, B. G. (1999) · Proceedings of the National Academy of Sciences · doi:10.1073/pnas.96.10.5592 · Cited by 248
Unravelling Colletotrichum species associated with Camellia : employing ApMat and GS loci to resolve species in the C. gloeosporioides complex
Liu, F., Weir, B. S., Damm, U., Crous, P. W., Wang, Y., Liu, B., Wang, M., Zhang, M., & Cai, L. (2015) · Persoonia - Molecular Phylogeny and Evolution of Fungi · doi:10.3767/003158515x687597 · Cited by 239
Systematic reappraisal of species in Phoma section Paraphoma , Pyrenochaeta and Pleurophoma
de Gruyter, J., Woudenberg, J. H. C., Aveskamp, M. M., Verkley, G. J. M., Groenewald, J. Z., & Crous, P. W. (2010) · Mycologia · doi:10.3852/09-240 · Cited by 237
“The genus Phoma is characterized by hyaline, unicellular conidia that may become septate due to secondary septation, phialidic, ampulliform to doliiform conidiogenous cells and (sub)globose, glabrous to pilose or setose, pseudoparenchymatous or scleroplectenchymatous pycnidia.”
BackgroundMethod
National Surveillance of Fungemia in Denmark (2004 to 2009)
Arendrup, M. C., Bruun, B., Christensen, J. J., Fuursted, K., Johansen, H. K., Kjældgaard, P., Knudsen, J. D., Kristensen, L., Møller, J., Nielsen, L., et al. (2011) · Journal of Clinical Microbiology · doi:10.1128/jcm.01811-10 · Cited by 223
Production, characterization, and antifungal activity of a biosurfactant produced by Rhodotorula babjevae YS3
Sen, S., Borah, S. N., Bora, A., & Deka, S. (2017) · Microbial Cell Factories · doi:10.1186/s12934-017-0711-z · Cited by 205
“Regions of the rDNA containing the ITS and D1/D2 LSU domains were amplified using different combinations of the primers ITS1-F (CTTGGTCATT TAGAGGAAGTAA) [17], ITS1 (TCCGTAGGTGAACC TGCGG) [18], ITS4 (TCCTCCGCTTATTGATATGC) [18], and TW14 (GCTATCCTGAGGGAAACTT) [19].”
Method
Breakthrough invasive candidiasis in patients on micafungin.
Pfeiffer, C. D., Garcia-Effron, G., Zaas, A. K., Perfect, J. R., Perlin, D. S., & Alexander, B. D. (2010) · Journal of Clinical Microbiology · doi:10.1128/jcm.02390-09 · Cited by 196
In Vivo Analysis of Secreted Aspartyl Proteinase Expression in Human Oral Candidiasis
Naglik, J. R., Newport, G., White, T. C., Fernandes-Naglik, L. L., Greenspan, J. S., Greenspan, D., Sweet, S. P., Challacombe, S. J., & Agabian, N. (1999) · Infection and Immunity · doi:10.1128/iai.67.5.2482-2490.1999 · Cited by 193
Self-citation
Genotypic and phenotypic diversity in Colletotrichum acutatum , a cosmopolitan pathogen causing anthracnose on a wide range of hosts
SREENIVASAPRASAD, S., & TALHINHAS, P. (2005) · Molecular Plant Pathology · doi:10.1111/j.1364-3703.2005.00291.x · Cited by 176
A Side by Side Comparison of Bruker Biotyper and VITEK MS: Utility of MALDI-TOF MS Technology for Microorganism Identification in a Public Health Reference Laboratory
Lévesque, S., Dufresne, P. J., Soualhine, H., Domingo, M.-C., Bekal, S., Lefebvre, B., & Tremblay, C. (2015) · PLOS ONE · doi:10.1371/journal.pone.0144878 · Cited by 172
Characterization of Colletotrichum acutatum Isolates Causing Anthracnose of Almond and Peach in California
Adaskaveg, J. E., & Hartin, R. J. (1997) · Phytopathology® · doi:10.1094/phyto.1997.87.9.979 · Cited by 165
Comparative microbiome analysis of a Fusarium wilt suppressive soil and a Fusarium wilt conducive soil from the Châteaurenard region
Siegel-Hertz, K., Edel-Hermann, V., Chapelle, E., Terrat, S., Raaijmakers, J. M., & Steinberg, C. (2018) · Frontiers in Microbiology · doi:10.3389/fmicb.2018.00568 · Cited by 164
“For fungal identification, the variable internal transcribed spacer 1 (ITS1) region was amplified using specific fungal primers ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′) and ITS2 (5′- GCTGCGTTCTTCATCGATGC-3′; White et al., 1990; Gardes and Bruns, 1993; Buée et al., 2009).”
Method
Silage review: Using molecular approaches to define the microbial ecology of silage
McAllister, T. A., Dunière, L., Drouin, P., Xu, S., Wang, Y., Munns, K., & Zaheer, R. (2018) · Journal of Dairy Science · doi:10.3168/jds.2017-13704 · Cited by 162
Phylogeny and systematics of 18 Colletotrichum species based on ribosomal DNA spacer sequences
Sreenivasaprasad, S., Meehan, B. M., Mills, P. R., & Brown, A. E. (1996) · Genome · doi:10.1139/g96-064 · Cited by 158
Rapid Identification of Candida Species with Species-Specific DNA Probes
Elie, C. M., Lott, T. J., Reiss, E., & Morrison, C. J. (1998) · Journal of Clinical Microbiology · doi:10.1128/jcm.36.11.3260-3265.1998 · Cited by 159
Changing epidemiology of candidaemia in Australia
Chapman, B., Slavin, M., Marriott, D., Halliday, C., Kidd, S., Arthur, I., Bak, N., Heath, C. H., Kennedy, K., Morrissey, C. O., et al. (2016) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/dkw422 · Cited by 163
The effect of biochar feedstock, pyrolysis temperature, and application rate on the reduction of ammonia volatilisation from biochar-amended soil
Mandal, S., Donner, E., Vasileiadis, S., Skinner, W., Smith, E., & Lombi, E. (2018) · Science of The Total Environment · doi:10.1016/j.scitotenv.2018.01.312 · Cited by 149
Phylogenetic analysis reveals a cryptic species Blastomyces gilchristii, sp. nov. within the human pathogenic fungus Blastomyces dermatitidis.
Brown, E. M., McTaggart, L. R., Zhang, S. X., Low, D. E., Stevens, D. A., & Richardson, S. E. (2013) · PLoS ONE · doi:10.1371/journal.pone.0059237 · Cited by 148
Molecular Analyses of Colletotrichum Species from Almond and Other Fruits
Freeman, S., Minz, D., Jurkevitch, E., Maymon, M., & Shabi, E. (2000) · Phytopathology® · doi:10.1094/phyto.2000.90.6.608 · Cited by 143
Effects of biochar addition on greenhouse gas emissions and microbial responses in a short-term laboratory experiment
Yoo, G., & Kang, H. (2012) · Journal of Environmental Quality · doi:10.2134/jeq2011.0157 · Cited by 143
Diversity of spoilage fungi associated with various French dairy products
Garnier, L., Valence, F., Pawtowski, A., Auhustsinava-Galerne, L., Frotté, N., Baroncelli, R., Deniel, F., Coton, E., & Mounier, J. (2017) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2016.10.026 · Cited by 141
Habitat and Host Indicate Lineage Identity in Colletotrichum gloeosporioides s.l. from Wild and Agricultural Landscapes in North America
Doyle, V. P., Oudemans, P. V., Rehner, S. A., & Litt, A. (2013) · PLoS ONE · doi:10.1371/journal.pone.0062394 · Cited by 134
PCR and omics based techniques to study the diversity, ecology and biology of anaerobic fungi: insights, challenges and opportunities
Edwards, J. E., Forster, R. J., Callaghan, T. M., Dollhofer, V., Dagar, S. S., Cheng, Y., Chang, J., Kittelmann, S., Fliegerova, K., Puniya, A. K., et al. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.01657 · Cited by 130
Mixotrophic and photoautotrophic cultivation of 14 microalgae isolates from Saskatchewan, Canada: potential applications for wastewater remediation for biofuel production
Park, K. C., Whitney, C., McNichol, J. C., Dickinson, K. E., MacQuarrie, S., Skrupski, B. P., Zou, J., Wilson, K. E., O’Leary, S. J. B., & McGinn, P. J. (2012) · Journal of Applied Phycology · doi:10.1007/s10811-011-9772-2 · Cited by 124
Microbial composition of Kombucha determined using amplicon sequencing and shotgun metagenomics
Arıkan, M., Mitchell, A. L., Finn, R. D., & Gürel, F. (2020) · Journal of Food Science · doi:10.1111/1750-3841.14992 · Cited by 123
Lovastatin Has Significant Activity against Zygomycetes and Interacts Synergistically with Voriconazole
Chamilos, G., Lewis, R. E., & Kontoyiannis, D. P. (2006) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.50.1.96-103.2006 · Cited by 121
Phylogeny of Sarocladium (Hypocreales)
Giraldo, A., Gené, J., Sutton, D. A., Madrid, H., de Hoog, G. S., Cano, J., Decock, C., Crous, P. W., & Guarro, J. (2015) · Persoonia - Molecular Phylogeny and Evolution of Fungi · doi:10.3767/003158515x685364 · Cited by 119
Phylogenetic relationships and pathogenicity of Colletotrichum acutatum isolates from grape in subtropical Australia
Whitelaw‐Weckert, M. A., Curtin, S. J., Huang, R., Steel, C. C., Blanchard, C. L., & Roffey, P. E. (2007) · Plant Pathology · doi:10.1111/j.1365-3059.2007.01569.x · Cited by 110
A comprehensive method for amplicon-based and metagenomic characterization of viruses, bacteria, and eukaryotes in freshwater samples
Uyaguari-Diaz, M. I., Chan, M., Chaban, B. L., Croxen, M. A., Finke, J. F., Hill, J. E., Peabody, M. A., Van Rossum, T., Suttle, C. A., Brinkman, F. S. L., et al. (2016) · Microbiome · doi:10.1186/s40168-016-0166-1 · Cited by 104
Competition assays and physiological experiments of soil and phyllosphere yeasts identify Candida subhashii as a novel antagonist of filamentous fungi
Hilber-Bodmer, M., Schmid, M., Ahrens, C. H., & Freimoser, F. M. (2017) · BMC Microbiology · doi:10.1186/s12866-016-0908-z · Cited by 106
“In cases where MALDI-TOF did not allow species identification, the fungal ITS region was amplified with primers ITS1f [50] and ITS4 [51], PCR products were directly used for sequencing, and all isolates were assigned a species hypothesis according to the UNITE database [52, 53] (see also Table 1).”
Method
Nucleotide sequence of the rDNA spacer 1 enables identification of isolates of Colletotrichum as C. acutatum
Sreenivasaprasad, S., Mills, P. R., & Brown, A. E. (1994) · Mycological Research · doi:10.1016/s0953-7562(09)80184-6 · Cited by 99
Grouping of Colletotrichum Species in Japan Based on rDNA Sequences
MORIWAKI, J., TSUKIBOSHI, T., & SATO, T. (2002) · Journal of General Plant Pathology · doi:10.1007/pl00013096 · Cited by 95
Bioremediation potential of hydrocarbon-utilizing fungi from select marine niches of India
Barnes, N. M., Khodse, V. B., Lotlikar, N. P., Meena, R. M., & Damare, S. R. (2018) · 3 Biotech · doi:10.1007/s13205-017-1043-8 · Cited by 92
Genetic Diversity, Morphological Uniformity and Polyketide Production in Dinoflagellates (Amphidinium, Dinoflagellata)
Murray, S. A., Garby, T., Hoppenrath, M., & Neilan, B. A. (2012) · PLoS ONE · doi:10.1371/journal.pone.0038253 · Cited by 90
Postbloom Fruit Drop of Citrus and Key Lime Anthracnose Are Caused by Distinct Phylogenetic Lineages of Colletotrichum acutatum
Peres, N. A., MacKenzie, S. J., Peever, T. L., & Timmer, L. W. (2008) · Phytopathology® · doi:10.1094/phyto-98-3-0345 · Cited by 81
Killer toxin from several food-derived Debaryomyces hansenii strains effective against pathogenic Candida yeasts
Banjara, N., Nickerson, K. W., Suhr, M. J., & Hallen-Adams, H. E. (2016) · International Journal of Food Microbiology · doi:10.1016/j.ijfoodmicro.2016.01.016 · Cited by 79
Genetic Diversity Within Colletotrichum acutatum sensu Simmonds
Freeman, S., Minz, D., Maymon, M., & Zveibil, A. (2001) · Phytopathology® · doi:10.1094/phyto.2001.91.6.586 · Cited by 78
In Vitro Antifungal Resistance of Candida auris Isolates from Bloodstream Infections, South Africa
Maphanga, T. G., Naicker, S. D., Kwenda, S., Muñoz, J. F., van Schalkwyk, E., Wadula, J., Nana, T., Ismail, A., Coetzee, J., Govind, C., et al. (2021) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.00517-21 · Cited by 78
Biocontrol ability and volatile organic compounds production as a putative mode of action of yeast strains isolated from organic grapes and rye grains
Choińska, R., Piasecka-Jóźwiak, K., Chabłowska, B., Dumka, J., & Łukaszewicz, A. (2020) · Antonie van Leeuwenhoek · doi:10.1007/s10482-020-01420-7 · Cited by 77
Efficacy of delayed therapy with Fosmanogepix (APX001) in a murine model of Candida auris invasive candidiasis
Wiederhold, N. P., Najvar, L. K., Shaw, K. J., Jaramillo, R., Patterson, H., Olivo, M., Catano, G., & Patterson, T. F. (2019) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.01120-19 · Cited by 71
Decatransin, a novel natural product inhibiting protein translocation at the Sec61/SecY translocon
Junne, T., Wong, J., Studer, C., Aust, T., Bauer, B. W., Beibel, M., Bhullar, B., Bruccoleri, R., Eichenberger, J., Estoppey, D., et al. (2015) · Journal of Cell Science · doi:10.1242/jcs.165746 · Cited by 67
Candida palmioleophila: characterization of a previously overlooked pathogen and its unique susceptibility profile in comparison with five related species.
Jensen, R. H., & Arendrup, M. C. (2011) · Journal of Clinical Microbiology · doi:10.1128/jcm.02071-10 · Cited by 68
Allium sativum Extract Chemical Composition, Antioxidant Activity and Antifungal Effect against Meyerozyma guilliermondii and Rhodotorula mucilaginosa Causing Onychomycosis
Pârvu, M., Moţ, C. A., Pârvu, A. E., Mircea, C., Stoeber, L., Roşca-Casian, O., & Ţigu, A. B. (2019) · Molecules · doi:10.3390/molecules24213958 · Cited by 66
Probiotic and antifungal attributes of Levilactobacillus brevis MYSN105, isolated from an Indian traditional fermented food Pozha
Somashekaraiah, R., Mottawea, W., Gunduraj, A., Joshi, U., Hammami, R., & Sreenivasa, M. Y. (2021) · Frontiers in Microbiology · doi:10.3389/fmicb.2021.696267 · Cited by 66
Potential of using sodium bicarbonate as external carbon source to cultivate microalga in non-sterile condition
Tu, Z., Liu, L., Lin, W., Xie, Z., & Luo, J. (2018) · Bioresource Technology · doi:10.1016/j.biortech.2018.06.076 · Cited by 65
Ribosomal DNA polymorphisms in the yeast Geotrichum candidum
Alper, I., Frenette, M., & Labrie, S. (2011) · Fungal Biology · doi:10.1016/j.funbio.2011.09.002 · Cited by 64
Breakthrough Candidemia Due to Multidrug-Resistant Candida glabrata during Prophylaxis with a Low Dose of Micafungin
Bizerra, F. C., Jimenez-Ortigosa, C., Souza, A. C. R., Breda, G. L., Queiroz-Telles, F., Perlin, D. S., & Colombo, A. L. (2014) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.02189-13 · Cited by 63
Identification of the major yeasts isolated from high moisture corn and corn silages in the United States using genetic and biochemical methods
Santos, M. C., Golt, C., Joerger, R. D., Mechor, G. D., Mourão, G. B., & Kung, L. (2017) · Journal of Dairy Science · doi:10.3168/jds.2016-11450 · Cited by 60
An Investigation into Rumen Fungal and Protozoal Diversity in Three Rumen Fractions, during High-Fiber or Grain-Induced Sub-Acute Ruminal Acidosis Conditions, with or without Active Dry Yeast Supplementation
Ishaq, S. L., AlZahal, O., Walker, N., & McBride, B. (2017) · Frontiers in Microbiology · doi:10.3389/fmicb.2017.01943 · Cited by 61
“The Internal Transcribed Spacer 1 region (ITS1) of fungi was amplified using the primers ITS5 (5′-GGAAGTAAAAGTCGTAACAAG G-3′) and ITS2 (5′-GCTGCGTTCTTCATCGATGC-3′) (White et al., 1990).”
Method
Taxonomical classification of yeasts isolated from kefir based on the sequence of their ribosomal RNA genes
Latorre-García, L., del Castillo-Agudo, L., & Polaina, J. (2007) · World Journal of Microbiology and Biotechnology · doi:10.1007/s11274-006-9298-y · Cited by 58
Evaluation of the possible influence of trailing and paradoxical effects on the clinical outcome of patients with candidemia
Rueda, C., Puig-Asensio, M., Guinea, J., Almirante, B., Cuenca-Estrella, M., Zaragoza, O., Padilla, B., Muñoz, P., Guinea, J., Paño Pardo, J. R., et al. (2017) · Clinical Microbiology and Infection · doi:10.1016/j.cmi.2016.09.016 · Cited by 58
Sequence or structure?
Mitchell, J. I., Roberts, P. J., & Moss, S. T. (1995) · Mycologist · doi:10.1016/s0269-915x(09)80212-7 · Cited by 54
In vitro anti-Candida activity of selective serotonin reuptake inhibitors against fluconazole-resistant strains and their activity against biofilm-forming isolates
Costa Silva, R. A., da Silva, C. R., de Andrade Neto, J. B., da Silva, A. R., Campos, R. S., Sampaio, L. S., do Nascimento, F. B. S. A., da Silva Gaspar, B., da Cruz Fonseca, S. G., Josino, M. A. A., et al. (2017) · Microbial Pathogenesis · doi:10.1016/j.micpath.2017.04.008 · Cited by 56
The devil in the details: interactions between the branch-length prior and likelihood model affect node support and branch lengths in the phylogeny of the Psoraceae
Ekman, S., & Blaalid, R. (2011) · Systematic Biology · doi:10.1093/sysbio/syr022 · Cited by 51
Colletotrichum species associated with pre-and post-harvest diseases of avocado and mango in eastern Australia
Giblin, F. R., Tan, Y. P., Mitchell, R., Coates, L. M., Irwin, J. A. G., & Shivas, R. G. (2018) · Australasian Plant Pathology · doi:10.1007/s13313-018-0553-0 · Cited by 51
Differential expression of Candida albicans secreted aspartyl proteinase in human vulvovaginal candidiasis
Lian, C. H., & Liu, W. D. (2007) · Mycoses · doi:10.1111/j.1439-0507.2007.01384.x · Cited by 49
Microbiological and molecular determination of mycobiota in fresh and ensiled maize silage
Mansfield, M. A., & Kuldau, G. A. (2007) · Mycologia · doi:10.1080/15572536.2007.11832586 · Cited by 79
Antifungal resistance to fluconazole and echinocandins is not emerging in yeast isolates causing fungemia in a Spanish tertiary care center.
Marcos-Zambrano, L. J., Escribano, P., Sánchez, C., Muñoz, P., Bouza, E., & Guinea, J. (2014) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.02670-14 · Cited by 49
Set of Classical PCRs for Detection of Mutations in Candida glabrata FKS Genes Linked with Echinocandin Resistance
Dudiuk, C., Gamarra, S., Leonardeli, F., Jimenez-Ortigosa, C., Vitale, R. G., Afeltra, J., Perlin, D. S., & Garcia-Effron, G. (2014) · Journal of Clinical Microbiology · doi:10.1128/jcm.01038-14 · Cited by 50
Ecological restoration of a copper polluted vineyard: long-term impact of farmland abandonment on soil bio-chemical properties and microbial communities
Cavani, L., Manici, L. M., Caputo, F., Peruzzi, E., & Ciavatta, C. (2016) · Journal of Environmental Management · doi:10.1016/j.jenvman.2016.07.050 · Cited by 46
Influence of Photobioreactor Set-up on the Survival of Microalgae Inoculum
Bani, A., Fernandez, F. G. A., D'Imporzano, G., Parati, K., & Adani, F. (2021) · Bioresource Technology · doi:10.1016/j.biortech.2020.124408 · Cited by 42
Resolution of Discrepant Results for Candida Species Identification by Using DNA Probes
Coignard, C., Hurst, S. F., Benjamin, L. E., Brandt, M. E., Warnock, D. W., & Morrison, C. J. (2004) · Journal of Clinical Microbiology · doi:10.1128/jcm.42.2.858-861.2004 · Cited by 41
Sphaeropsis sapinea and associated endophytes in Scots pine: Interactions and effect on the host under variable water content
Blumenstein, K., Bußkamp, J., Langer, G. J., Schlößer, R., Parra Rojas, N. M., & Terhonen, E. (2021) · Frontiers in Forests and Global Change · doi:10.3389/ffgc.2021.655769 · Cited by 39
Lipid accumulation by Coelastrella multistriata (Scenedesmaceae, Sphaeropleales) during nitrogen and phosphorus starvation
Maltsev, Y., Krivova, Z., Maltseva, S., Maltseva, K., Gorshkova, E., & Kulikovskiy, M. (2021) · Scientific Reports · doi:10.1038/s41598-021-99376-9 · Cited by 40
Species diversity of Pseudocercospora from Far East Asia
Nakashima, C., Motohashi, K., Chen, C.-Y., Groenewald, J. Z., & Crous, P. W. (2016) · Mycological Progress · doi:10.1007/s11557-016-1231-7 · Cited by 38
Micafungin breakthrough fungemia in patients with hematological disorders
Kimura, M., Araoka, H., Yamamoto, H., Nakamura, S., Nagi, M., Yamagoe, S., Miyazaki, Y., Ogura, S., Mitsuki, T., Yuasa, M., et al. (2018) · Antimicrobial Agents and Chemotherapy · doi:10.1128/aac.02183-17 · Cited by 37
Scope and frequency of fluconazole trailing assessed using EUCAST in invasive Candida spp. isolates
Marcos-Zambrano, L. J., Escribano, P., Sánchez-Carrillo, C., Bouza, E., & Guinea, J. (2016) · Medical Mycology · doi:10.1093/mmy/myw033 · Cited by 33
Adaptation to thermotolerance in Rhizopus coincides with virulence as revealed by avian and invertebrate infection models, phylogeny, physiological and metabolic flexibility
Kaerger, K., Schwartze, V. U., Dolatabadi, S., Nyilasi, I., Kovács, S. A., Binder, U., Papp, T., Hoog, S. D., Jacobsen, I. D., & Voigt, K. (2015) · Virulence · doi:10.1080/21505594.2015.1029219 · Cited by 35
Effect of dry matter content on the microbial community and on the effectiveness of a microbial inoculant to improve the aerobic stability of corn silage
Benjamim da Silva, É., Liu, X., Mellinger, C., Gressley, T. F., Stypinski, J. D., Moyer, N. A., & Kung, L. (2022) · Journal of Dairy Science · doi:10.3168/jds.2021-21515 · Cited by 36
Yeasts found on an ephemeral reproductive caste of the leaf-cutting ant Atta sexdens rubropilosa
Arcuri, S. L., Pagnocca, F. C., da Paixão Melo, W. G., Nagamoto, N. S., Komura, D. L., & Rodrigues, A. (2014) · Antonie van Leeuwenhoek · doi:10.1007/s10482-014-0216-2 · Cited by 35
A species-specific PCR based assay for rapid detection of mango anthracnose pathogen Colletotrichum gloeosporioides Penz. And Sacc
Kamle, M. (2013) · Journal of Plant Pathology & Microbiology · doi:10.4172/2157-7471.1000184 · Cited by 30
A New Species of Freshwater Algae Nephrochlamys yushanlensis sp. nov. (Selenastraceae, Sphaeropleales) and Its Lipid Accumulation during Nitrogen and Phosphorus Starvation
Maltsev, Y., Maltseva, I., Maltseva, S., Kociolek, J. P., & Kulikovskiy, M. (2021) · Journal of Phycology · doi:10.1111/jpy.13116 · Cited by 31
Molecular epidemiology, antifungal susceptibility, and ERG11 gene mutation of Candida species isolated from vulvovaginal candidiasis: Comparison between recurrent and non-recurrent infections
Esfahani, A., Omran, A. N., Salehi, Z., Shams-Ghahfarokhi, M., Ghane, M., Eybpoosh, S., & Razzaghi-Abyaneh, M. (2022) · Microbial Pathogenesis · doi:10.1016/j.micpath.2022.105696 · Cited by 30
Description of a new species of soil algae, Parietochloris grandis sp. nov., and study of its fatty acid profiles under different culturing conditions
Maltsev, Y., Gusev, E., Maltseva, I., Kulikovskiy, M., Namsaraev, Z., Petrushkina, M., Filimonova, A., Sorokin, B., Golubeva, A., Butaeva, G., et al. (2018) · Algal Research · doi:10.1016/j.algal.2018.06.008 · Cited by 29
Fatty Acid Content and Profile of the Novel Strain of Coccomyxa elongata (Trebouxiophyceae, Chlorophyta) Cultivated at Reduced Nitrogen and Phosphorus Concentrations
Maltsev, Y., Maltseva, I., Maltseva, S., Kociolek, J. P., & Kulikovskiy, M. (2019) · Journal of Phycology · doi:10.1111/jpy.12903 · Cited by 28
Characterization of Candida sp. NY7122, a novel pentose-fermenting soil yeast
Watanabe, I., Ando, A., & Nakamura, T. (2012) · Journal of Industrial Microbiology and Biotechnology · doi:10.1007/s10295-011-1033-5 · Cited by 27
Antifungal resistance does not necessarily affect Candida glabrata fitness
Borghi, E., Andreoni, S., Cirasola, D., Ricucci, V., Sciota, R., & Morace, G. (2014) · Journal of Chemotherapy · doi:10.1179/1973947813y.0000000100 · Cited by 25
Cultivar Resistance against Colletotrichum asianum in the World Collection of Mango Germplasm in Southeastern Brazil
Vitale, A., Alfenas, A. C., de Siqueira, D. L., Magistà, D., Perrone, G., & Polizzi, G. (2020) · Plants · doi:10.3390/plants9020182 · Cited by 24
A new Colletotrichum species causing anthracnose of chilli in the Philippines and its pathogenicity to chilli cultivar Django
Dela Cueva, F. M., Mendoza, J. S., & Balendres, M. A. (2018) · Crop Protection · doi:10.1016/j.cropro.2018.06.011 · Cited by 25
Identification ofTrichoderma biocontrol isolates to clades according to ap-PCR and ITS sequence analyses
Maymon, M., Minz, D., Barbul, O., Zveibil, A., Elad, Y., & Freeman, S. (2004) · Phytoparasitica · doi:10.1007/bf02979848 · Cited by 22
Microbiota survey of sliced cooked ham during the secondary shelf life
Spampinato, G., Candeliere, F., Amaretti, A., Licciardello, F., Rossi, M., & Raimondi, S. (2022) · Frontiers in Microbiology · doi:10.3389/fmicb.2022.842390 · Cited by 22
Occurrence and Characterization of Candida nivariensis from a Culture Collection of Candida glabrata Clinical Isolates in Malaysia
Tay, S. T., Lotfalikhani, A., Sabet, N. S., Ponnampalavanar, S., Sulaiman, S., Na, S. L., & Ng, K. P. (2014) · Mycopathologia · doi:10.1007/s11046-014-9778-9 · Cited by 22
Detection of Phytophthora cinnamomi in Forest Soils by PCR on DNA Extracted from Leaf Disc Baits
Sena, K., Dreaden, T. J., Crocker, E., & Barton, C. (2018) · Plant Health Progress · doi:10.1094/php-01-18-0004-rs · Cited by 19
Molecular characterization of Colletotrichum isolates associated with anthracnose of mango fruit
Zakaria, L., Juhari, N. Z., Iskandar Vijaya, S., & Mohd. Anuar, I. S. (2015) · Sains Malaysiana · doi:10.17576/jsm-2015-4405-02 · Cited by 17
Colletotrichum asianum causes anthracnose in Philippine mango cv. Carabao
Alvarez, L. V., Hattori, Y., Deocaris, C. C., Mapanao, C. P., Bautista, A. B., Cano, M. J. B., Naito, K., Kitabata, S., Motohashi, K., & Nakashima, C. (2020) · Australasian Plant Disease Notes · doi:10.1007/s13314-020-00384-x · Cited by 17

Authors: White, T. J., Bruns, T., Lee, S., & Taylor, J.
Affiliations: Food and Agriculture Organization of the United Nations (IT)
ORCID: White, T.J.
Bruns, T.
Lee, S.
Taylor, J.
Venue: PCR Protocols
Publisher: Elsevier
Published: 1990
Pages: 315-322
DOI: 10.1016/b978-0-12-372180-8.50042-1
OpenAlex: W2120644786
Cited by: 36,648
References: 0
Citations by year: 2026: 1215 · 2025: 2070 · 2024: 2144 · 2023: 2051 · 2022: 2236 · 2021: 2431 · 2020: 2310 · 2019: 2024 · 2018: 1874 · 2017: 1660 · 2016: 1763 · 2015: 1663 · 2014: 1495 · 2013: 1370 · 2012: 1407
FWCI: 62.13
Type: book chapter
Language: en
Open access: closed
Licence: www.elsevier.com/tdm/userlicense/1.0/ (tdm)
Locations: Elsevier eBooks (publishedVersion)
Topics: Life Sciences › Agricultural and Biological Sciences › Plant Science › Banana Cultivation and Research
Life Sciences › Agricultural and Biological Sciences › Plant Science › Plant Pathogens and Fungal Diseases
Life Sciences › Immunology and Microbiology › Microbiology › Yeasts and Rust Fungi Studies
Keywords: Fusarium oxysporum f. sp. cubense, Fusarium wilt, banana, plantain, ITS region, EF-1α, RPB2, species complex, Fusarium oxysporum species complex, Fusarium fujikuroi, Fusarium solani, haplotypes, pathogenicity, Colombia

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review

AMPLIFICATION AND DIRECT SEQUENCING OF FUNGAL RIBOSOMAL RNA GENES FOR PHYLOGENETICS

Overview

Integrity signals

Verification

Claims the paper makes

Citations

Cites

Cited by

Metadata

Record

About these checks