Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota
Open accessAbstract
Fecal bacteria were studied in healthy elderly volunteers (age, 63 to 90 years;n= 35) living in the local community, elderly hospitalized patients (age, 66 to 103;n= 38), and elderly hospitalized patients receiving antibiotic treatment (age, 65 to 100;n= 21). Group- and species-specific primer sets targeting 16S rRNA genes were used to quantitate intestinal bacteria by using DNA extracted from feces and real-time PCR. The principal difference between healthy elderly volunteers and both patient cohorts was a marked reduction in the Bacteroides-Prevotella group following hospitalization. Reductions in bifidobacteria,Desulfovibrio spp.,Clostridium clostridiiforme, and Faecalibacterium prausnitzii were also found in the hospitalized patients. However, total 16S rRNA gene copy numbers (per gram of wet weight of feces) were generally lower in the stool samples of the two groups of hospitalized patients compared to the number in the stool samples of elderly volunteers living in the community, so the relative abundance (percentage of the group- and species-specific rRNA gene copies in relation to total bacterial rRNA gene copies) of bifidobacteria,Desulfovibrio spp.,C. clostridiiforme, and F. prausnitzii did not change. Antibiotic treatment resulted in further reductions in the numbers of bacteria and their prevalence and, in some patients, complete elimination of certain bacterial communities. Conversely, the numbers of enterobacteria increased in the hospitalized patients who did not receive antibiotics, and due to profound changes in fecal microbiotas during antibiotic treatment, the opportunistic species Enterococcus faecalis proliferated.
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Integrity signals
Registry
Cites
Statistics
Claims the paper makes
The claims and statistics of this paper haven’t been checked yet.
Run the check — free, no account needed. It reads the open-access text and checks the sources it cites.
Claims other papers make about this one
Each is checked against this paper’s own text: does it say what the citing paper says it does?
Specific microbial taxa are associated with reduced frailty in elderly populations, including Bacteroidetes.
“Specific microbial taxa are also associated with reduced frailty in elderly populations, including Bacteroidetes”
From The Microbiota-Gut-Brain Axis (2019) · cites this paper as Bartosch et al., 2004
The Results report substantially higher Bacteroides–Prevotella counts in healthy community-dwelling elderly volunteers than in hospitalized elderly patients. The Discussion attributes the decrease to hospitalization; the paper does not establish an association between the broader Bacteroidetes phylum and a measured reduction in frailty. (LLM, conf=0.86)
Experimental — accuracy not yet measured
Self-check
Percentages, sums and reported differences re-computed from the paper’s own numbers.
The self-check needs the paper’s full text.
Cites
Bergey's Manual of Systematic Bacteriology
(1990) · Annals of Internal Medicine · doi:10.7326/0003-4819-112-5-391_3 · Cited by 15,633 · see citing works
Nadkarni, M. A., Martin, F. E., Jacques, N. A., & Hunter, N. (2002) · Microbiology · doi:10.1099/00221287-148-1-257 · Cited by 1,931 · see citing works
Suau, A., Bonnet, R., Sutren, M., Godon, J.-J., Gibson, G. R., Collins, M. D., & Doré, J. (1999) · Applied and Environmental Microbiology · doi:10.1128/aem.65.11.4799-4807.1999 · Cited by 1,490 · see citing works
Cole, J. R. (2003) · Nucleic Acids Research · doi:10.1093/nar/gkg039 · Cited by 1,432 · see citing works
Zoetendal, E. G., Akkermans, A. D. L., & de Vos, W. M. (1998) · Applied and Environmental Microbiology · doi:10.1128/aem.64.10.3854-3859.1998 · Cited by 1,360 · see citing works
rrndb: the Ribosomal RNA Operon Copy Number Database
Klappenbach, J., Saxman, P., Cole, J., & Schmidt, T. M. (2001) · Nucleic Acids Res. · doi:10.1093/nar/29.1.181 · Cited by 1,140 · see citing works
Langendijk-Genevaux, P. S., Schut, F., Jansen, G. J., Raangs, G. C., Kamphuis, G. R., Wilkinson, M. H. F., & Welling, G. W. (1995) · Applied and Environmental Microbiology · doi:10.1128/aem.61.8.3069-3075.1995 · Cited by 974 · see citing works
Effect of antimicrobial agents on the ecological balance of human microflora
Sullivan, Å., Edlund, C., & Nord, C. E. (2001) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(01)00066-4 · Cited by 816 · see citing works
Duncan, S. H., Hold, G. L., Harmsen, H. J. M., Stewart, C. S., & Flint, H. J. (2002) · INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY · doi:10.1099/00207713-52-6-2141 · Cited by 735 · see citing works
Matsuki, T., Watanabe, K., Fujimoto, J., Miyamoto, Y., Takada, T., Matsumoto, K., Oyaizu, H., & Tanaka, R. (2002) · Applied and Environmental Microbiology · doi:10.1128/aem.68.11.5445-5451.2002 · Cited by 656 · see citing works
Kleessen, B., Sykura, B., Zunft, H. ‐., & Blaut, M. (1997) · American Journal of Clinical Nutrition · doi:10.1093/ajcn/65.5.1397 · Cited by 586 · see citing works
Hopkins, M. J., Sharp, R., & Macfarlane, G. T. (2001) · Gut · doi:10.1136/gut.48.2.198 · Cited by 577 · see citing works
Self-citationBernhard, A. E., & Field, K. G. (2000) · Applied and Environmental Microbiology · doi:10.1128/aem.66.4.1587-1594.2000 · Cited by 515 · see citing works
PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples
Wang, R. F., Cao, W. W., & Cerniglia, C. E. (1996) · Applied and Environmental Microbiology · doi:10.1128/aem.62.4.1242-1247.1996 · Cited by 502 · see citing works
Hopkins, M. J., & Macfarlane, G. T. (2002) · Journal of Medical Microbiology · doi:10.1099/0022-1317-51-5-448 · Cited by 473 · see citing works
Self-citationRole of short-chain fatty acids in the prevention of colorectal cancer
Scheppach, W. M., Bartram, H.-P., & Richter, F. (1995) · European Journal of Cancer · doi:10.1016/0959-8049(95)00165-f · Cited by 362 · see citing works
BACTEROIDES OF THE HUMAN LOWER INTESTINAL TRACT
Salyers, A. A. (1984) · Annual Review of Microbiology · doi:10.1146/annurev.mi.38.100184.001453 · Cited by 309 · see citing works
Studies of Intestinal Microflora
Gorbach, S. L., Nahas, L., Lerner, P. I., & Weinstein, L. (1967) · Gastroenterology · doi:10.1016/s0016-5085(19)34121-6 · Cited by 284 · see citing works
Studies of Intestinal Microflora
Gorbach, S. L., Nahas, L., Plaut, A. G., Weinstein, L., Patterson, J. F., & Levitan, R. (1968) · Gastroenterology · doi:10.1016/s0016-5085(68)80072-1 · Cited by 243 · see citing works
Butyrate oxidation is impaired in the colonic mucosa of sufferers of quiescent ulcerative colitis.
Chapman, M., Grahn, M. F., Boyle, M. A., Hutton, M. R. E., Rogers, J. E., & Williams, N. S. (1994) · Gut · doi:10.1136/gut.35.1.73 · Cited by 241 · see citing works
Fite, A., Macfarlane, G. T., Cummings, J. H., Hopkins, M. J., Kong, S. C., Furrie, E., & Macfarlane, S. (2004) · Gut · doi:10.1136/gut.2003.031245 · Cited by 199 · see citing works
Self-citationEffect of changing transit time on colonic microbial metabolism in man.
Stephen, A. M., Wiggins, H. S., & Cummings, J. H. (1987) · Gut · doi:10.1136/gut.28.5.601 · Cited by 183 · see citing works
Dore, J. M., Sghir, A., Gramet, G., Corthier, G., & Pochart, P. (1998) · Systematic and Applied Microbiology · doi:10.1016/s0723-2020(98)80009-x · Cited by 171 · see citing works
Postprandial colonic transit and motor activity in chronic constipation
Bazzocchi, G., Ellis, J., Villanueva‐Meyer, J., Jing, J., Reddy, S. N., Mena, I., & Snape, W. J. (1990) · Gastroenterology · doi:10.1016/0016-5085(90)90289-d · Cited by 170 · see citing works
Foodborne Illness in the Elderly
Smith, J. L. (1998) · Journal of Food Protection · doi:10.4315/0362-028x-61.9.1229 · Cited by 145 · see citing works
Age related changes in gut physiology and nutritional status.
Lovat, L. B. (1996) · Gut · doi:10.1136/gut.38.3.306 · Cited by 136 · see citing works
Nutrition, ageing and ill health
Gariballa, S., & Sinclair, A. J. (1998) · British Journal Of Nutrition · doi:10.1017/s000711459800172x · Cited by 126 · see citing works
Macfarlane, G. T., & Gibson, G. R. (1991) · doi:10.1093/oso/9780199632046.003.0011 · Cited by 115 · see citing works
Self-citationGavini, F., Cayuela, C., Antoine, J., Lecoq, C., Lefebvre, B., Membré, J., & Neut, C. (2001) · Microbial Ecology in Health and Disease · doi:10.3402/mehd.v13i1.7998 · Cited by 98 · see citing works
Lode, H. M. (2001) · Scandinavian Journal of Infectious Diseases · doi:10.1080/00365540110076714 · Cited by 95 · see citing works
Holdstock, D., & Misiewicz, J. J. (1970) · Gut · doi:10.1136/gut.11.2.100 · Cited by 92 · see citing works
Ecology of Bifidobacterium in the Human Intestinal Flora
Mutai, M., & Tanaka, R. (1987) · Bifidobacteria and Microflora · doi:10.12938/bifidus1982.6.2_33 · Cited by 67 · see citing works
Butyrate metabolism in the terminal ileal mucosa of patients with ulcerative colitis
Chapman, M., Grahn, M. F., Hutton, M. R. E., & Williams, N. S. (1995) · British journal of surgery · doi:10.1002/bjs.1800820115 · Cited by 66 · see citing works
Anaerobic microbiology :a practical approach
Levett, P. N. (1991) · Oxford University Press eBooks · Cited by 59 · see citing works
Edlund, C., Stark, C., & Nord, C. E. (1994) · Journal of Antimicrobial Chemotherapy · doi:10.1093/jac/34.1.127 · Cited by 51 · see citing works
Macfarlane, G. T., & Gibson, G. R. (1991) · Applied and Environmental Microbiology · doi:10.1128/aem.57.1.1-6.1991 · Cited by 43 · see citing works
Self-citationComparison of carbohydrate substrate preferences in eight species of bifidobacteria
Degnan, B. A. (1991) · FEMS Microbiology Letters · doi:10.1016/0378-1097(91)90119-u · Cited by 36 · see citing works
Lesourd, B., Laisney, C., Salvatore, R., Meaume, S., & Moulias, R. (1994) · Archives of Gerontology and Geriatrics · doi:10.1016/s0167-4943(05)80059-7 · Cited by 31 · see citing works
Colonic fermentation of complex carbohydrates in patients with familial adenomatous polyposis.
Bradburn, D. M., Mathers, J. C., Gunn, A., Burn, J., Chapman, P. D., & Johnston, I. D. A. (1993) · Gut · doi:10.1136/gut.34.5.630 · Cited by 29 · see citing works
Serum antibodies to commensal oral and gut bacteria vary with age
Percival, R. S., Marsh, P. D., & Challacombe, S. (1996) · FEMS Immunology & Medical Microbiology · doi:10.1111/j.1574-695x.1996.tb00356.x · Cited by 27 · see citing works
MITSUOKA, T., Hayakawa, K., & Kimura, N. (1974) · PubMed · Cited by 26 · see citing works
(1997) · Water Science & Technology · doi:10.1016/s0273-1223(97)00300-4 · Cited by 26 · see citing works
Colonic transit times and the effect of lactulose or lactitol in hospitalized patients.
Pontes, F. A., Silva, A. T., & Cruz, A. C. (1995) · PubMed · Cited by 22 · see citing works
Christensson, B., Nilsson-Ehle, I., Ljungberg, B., Nömm, I., Oscarsson, G., Nordström, L., Goscinski, G., Löwdin, E., Linglöf, T., Nordström, B., et al. (1991) · Infection · doi:10.1007/bf01644947 · Cited by 21 · see citing works
Slade, A. P., Wyatt, G. M., Bayliss, C. E., & Waites, W. M. (1987) · Journal of Applied Bacteriology · doi:10.1111/j.1365-2672.1987.tb02404.x · Cited by 15 · see citing works
Meier, H., Koob, C., Ludwig, W., Amann, R., Frahm, E., Hoffmann, S., Obst, U., & SCHLEIFER, K. H. (1997) · Water Science & Technology · doi:10.2166/wst.1997.0774 · Cited by 13 · see citing works
Garg, S. K., & Mahajan, S. (1994) · Archives of Gerontology and Geriatrics · doi:10.1016/0167-4943(94)00541-9 · Cited by 12 · see citing works
DNA Extraction from Bacterial Cultures
Bazzicalupo, M., & Fancelli, S. (1997) · Springer eBooks · doi:10.1007/978-3-642-60441-6_7 · Cited by 11 · see citing works
Ross, D. G. (1993) · Orthopaedic Nursing · doi:10.1097/00006416-199309000-00007 · Cited by 8 · see citing works
Meeting the needs of the hospitalized elderly.
Et, F., Mp, W., & DOYLE, G. C. (1986) · PubMed · Cited by 2 · see citing works
Flagged first, then by citations
Research works printed but not linked: 2
- [14]Fite A., G. T. Macfarlane, J. H. Cummings, M. J. Hopkins, S. C. Kong, E. Furrie, S. Macfarlane. 2004. Identification and quantitation of mucosal and faecal desulfovibrios using real-time PCR. Gut 53:523-529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [32]Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalflora bei Menschen II. Mitteilung: Die Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Hyg. Abt. 1 Orig. A 226:469-478. [PubMed] [Google Scholar]
Cited by
Sorted by citations
Cryan, J. F., O'Riordan, K. J., Cowan, C. S. M., Sandhu, K. V., Bastiaanssen, T. F. S., Boehme, M., Codagnone, M. G., Cussotto, S., Fulling, C., Golubeva, A. V., et al. (2019) · Physiological Reviews · doi:10.1152/physrev.00018.2018 · Cited by 5,286 · see citing works
Gut Microbiota in Human Adults with Type 2 Diabetes Differs from Non-Diabetic Adults
Larsen, N., Vogensen, F. K., van den Berg, F. W. J., Nielsen, D. S., Andreasen, A. S., Pedersen, B. K., Al-Soud, W. A., Sørensen, S. J., Hansen, L. H., & Jakobsen, M. (2010) · PLoS ONE · doi:10.1371/journal.pone.0009085 · Cited by 2,952 · see citing works
Dethlefsen, L., Huse, S., Sogin, M. L., & Relman, D. A. (2008) · PLoS Biology · doi:10.1371/journal.pbio.0060280 · Cited by 2,361 · see citing works
“Studies comparing changes in the gut microbiota over time or between treatments have often used alternative molecular techniques that are more rapid and less expensive than sequencing, but that offer lower taxonomic resolution and reveal only the more abundant members of the community [23-25,34-37].”
BackgroundThe Firmicutes/Bacteroidetes ratio of the human microbiota changes with age
Mariat, D., Firmesse, O., Levenez, F., Guimarăes, V., Sokol, H., Doré, J., Corthier, G., & Furet, J.-P. (2009) · BMC Microbiology · doi:10.1186/1471-2180-9-123 · Cited by 1,755 · see citing works
Through Ageing, and Beyond: Gut Microbiota and Inflammatory Status in Seniors and Centenarians
Biagi, E., Nylund, L., Candela, M., Ostan, R., Bucci, L., Pini, E., Nikkïla, J., Monti, D., Satokari, R., Franceschi, C., et al. (2010) · PLoS ONE · doi:10.1371/journal.pone.0010667 · Cited by 1,483 · see citing works
“The uniqueness of this comparative study resides in the introduction of this third, extremely aged, group, alongside to the young and elderly adults that have been addressed by earlier studies”
Thevaranjan, N., Puchta, A., Schulz, C., Naidoo, A., Szamosi, J. C., Verschoor, C. P., Loukov, D., Schenck, L. P., Jury, J., Foley, K. P., et al. (2017) · Cell Host & Microbe · doi:10.1016/j.chom.2017.03.002 · Cited by 1,322 · see citing works
“, 2009) and that these changes correlate with health status in the elderly population (Bartosch et al., 2004; Claesson et al., 2012).”
Interaction between Phenolics and Gut Microbiota: Role in Human Health
Selma, M. V., Espín, J. C., & Tomás-Barberán, F. A. (2009) · Journal of Agricultural and Food Chemistry · doi:10.1021/jf902107d · Cited by 1,324 · see citing works
Reichardt, N., Duncan, S. H., Young, P., Belenguer, Á., Leitch, E. C. M., Scott, K. P., Flint, H. J., & Louis, P. (2014) · The ISME Journal · doi:10.1038/ismej.2014.14 · Cited by 1,302 · see citing works
Human colonic microbiota associated with diet, obesity and weight loss
Duncan, S. H., Lobley, G. E., Holtrop, G., Ince, J., Johnstone, A. M., Louis, P., & Flint, H. J. (2008) · International Journal of Obesity · doi:10.1038/ijo.2008.155 · Cited by 1,222 · see citing works
Long-term ecological impacts of antibiotic administration on the human intestinal microbiota
Jernberg, C., Löfmark, S., Edlund, C., & Jansson, J. K. (2007) · The ISME Journal · doi:10.1038/ismej.2007.3 · Cited by 1,134 · see citing works
Characterization of fecal microbial communities in patients with liver cirrhosis
Chen, Y., Yang, F., Lu, H., Wang, B., Chen, Y., Lei, D., Wang, Y., Zhu, B., & Li, L. (2011) · Hepatology · doi:10.1002/hep.24423 · Cited by 1,038 · see citing works
“Faecalibacterium prausnitzii Pfra-F 50-GATGGCCTCGCGTCCGATTAG-30 58 Bartosch et al.(25)”
BackgroundInfluentialMueller, S., Saunier, K., Hanisch, C., Norin, E., Alm, L., Midtvedt, T., Cresci, A., Silvi, S., Orpianesi, C., Verdenelli, M. C., et al. (2006) · Applied and Environmental Microbiology · doi:10.1128/aem.72.2.1027-1033.2006 · Cited by 1,006 · see citing works
“Progressive colonization seems to happen in old age where competitiveness and colonization resistance are often affected by medical treatment, in particular by antibiotics (3).”
BackgroundBelenguer, A., Duncan, S. H., Calder, A. G., Holtrop, G., Louis, P., Lobley, G. E., & Flint, H. J. (2006) · Applied and Environmental Microbiology · doi:10.1128/aem.72.5.3593-3599.2006 · Cited by 856 · see citing works
Ramirez-Farias, C., Slezak, K., Fuller, Z., Duncan, A., Holtrop, G., & Louis, P. (2008) · British Journal of Nutrition · doi:10.1017/s0007114508019880 · Cited by 822 · see citing works
Intestinal microbiota in human health and disease: the impact of probiotics
Gerritsen, J., Smidt, H., Rijkers, G. T., & de Vos, W. M. (2011) · Genes & Nutrition · doi:10.1007/s12263-011-0229-7 · Cited by 724 · see citing works
Gut Bifidobacteria Populations in Human Health and Aging
Arboleya, S., Watkins, C., Stanton, C., & Ross, R. P. (2016) · Frontiers in Microbiology · doi:10.3389/fmicb.2016.01204 · Cited by 683 · see citing works
“The same trend was observed by Bartosch et al. (2004) between elderly living in the local community and elderly in a hospitalized environment.”
BackgroundGut microbiome and aging: physiological and mechanistic insights
Nagpal, R., Mainali, R., Ahmadi, S., Wang, S., Singh, R., Kavanagh, K., Kitzman, D. W., Kushugulova, A., Marotta, F., & Yadav, H. (2018) · Nutrition and Healthy Aging · doi:10.3233/nha-170030 · Cited by 670 · see citing works
“between gut microbiota and host chronological aging 276 are still limited [8, 36, 73], but a reduced gut 277 microbiota diversity has been speculated to be asso278 ciated with increased old-age frailty [23, 31, 74, 75].”
BackgroundInfluentialStool microbiome and metabolome differences between colorectal cancer patients and healthy adults
Weir, T. L., Manter, D. K., Sheflin, A. M., Barnett, B. A., Heuberger, A. L., & Ryan, E. P. (2013) · PLoS ONE · doi:10.1371/journal.pone.0070803 · Cited by 642 · see citing works
The Microbiota of the Gut in Preschool Children With Normal and Excessive Body Weight
Karlsson, C., Önnerfält, J., Xu, J., Molin, G., Ahrné, S., & Thorngren‐Jerneck, K. (2012) · Obesity · doi:10.1038/oby.2012.110 · Cited by 536 · see citing works
Diet and the development of the human intestinal microbiome
Voreades, N., Kozil, A., & Weir, T. L. (2014) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00494 · Cited by 498 · see citing works
“…of the gut are: (1) physiological changes, (2) dietary choices and malnutrition, (3) living situation (community-dwelling, hospitalized, or long-term care), and (4) use of antibiotics (Bartosch et al., 2004; Woodmansey, 2007; Claesson et al., 2012) and other prescription drugs (Qato et al., 2008).”
BackgroundInfluentialIntestinal microbiota, diet and health
Power, S. E., O'Toole, P. W., Stanton, C., Ross, R. P., & Fitzgerald, G. F. (2014) · British Journal Of Nutrition · doi:10.1017/s0007114513002560 · Cited by 476 · see citing works
“Antibiotic treatment in hospitalised elderly subjects has been shown to increase the intestinal abundance of proteolytic bacteria((73)), to reduce overall bacterial numbers and, in some subjects, to completely eliminate certain bacterial communities((46)).”
Intestinal bacteria and ageing
Woodmansey, E. J. (2007) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2007.03400.x · Cited by 446 · see citing works
“Numerous studies have shown a decline in viable counts of bacteroides with increased age, an observation that is unsurprisingly magnified following antibiotic therapy (Hopkins and Macfarlane 2002; Bartosch et al. 2004; Woodmansey et al. 2004).”
BackgroundEnteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract
Barman, M., Unold, D., Shifley, K., Amir, E., Hung, K.-C., Bos, N. A., & Salzman, N. H. (2007) · Infection and Immunity · doi:10.1128/iai.01432-07 · Cited by 428 · see citing works
Microbes and the gut‐brain axis
Bercik, P., Collins, S. M., & Verdu, E. F. (2012) · Neurogastroenterology & Motility · doi:10.1111/j.1365-2982.2012.01906.x · Cited by 417 · see citing works
Tanaka, S., Kobayashi, T., Songjinda, P., Tateyama, A., Tsubouchi, M., Kiyohara, C., Shirakawa, T., Sonomoto, K., & Nakayama, J. (2009) · FEMS Immunology & Medical Microbiology · doi:10.1111/j.1574-695x.2009.00553.x · Cited by 396 · see citing works
“However, it is well-known that antibiotic exposure affects the ecological balance of gastrointestinal tract microbiota (Sullivan et al., 2001; Bartosch et al., 2004; Nord et al., 2006).”
BackgroundTechniques used to characterize the gut microbiota: a guide for the clinician
Fraher, M. H., O'Toole, P. W., & Quigley, E. M. M. (2012) · Nature Reviews Gastroenterology & Hepatology · doi:10.1038/nrgastro.2012.44 · Cited by 385 · see citing works
Functional metagenomic profiling of intestinal microbiome in extreme ageing
Rampelli, S., Candela, M., Turroni, S., Biagi, E., Collino, S., Franceschi, C., O'Toole, P. W., & Brigidi, P. (2013) · Aging · doi:10.18632/aging.100623 · Cited by 359 · see citing works
“physiology of the ageing process can ultimately compromise this homeostasis with a subject-specific timing, depending on the individual physiological status, diet, lifestyle and frailty [7-13].”
BackgroundAgeing of the human metaorganism: the microbial counterpart
Biagi, E., Candela, M., Fairweather‐Tait, S. J., Franceschi, C., & Brigidi, P. (2011) · AGE · doi:10.1007/s11357-011-9217-5 · Cited by 365 · see citing works
“…have different purposes, such as the relationship between microbiota and frailty (van Tongeren et al. 2005), the impact of antibiotic treatments (Bartosch et al. 2004; Woodmansey et al. 2004) and the differences between the GI health status of hospitalised and non-hospitalised patients…”
BackgroundInfluentialChapman, C., Gillespie, T., & Goldberg, T. L. (2005) · Evolutionary Anthropology Issues News and Reviews · doi:10.1002/evan.20068 · Cited by 328 · see citing works
Biagi, E., Nylund, L., Candela, M., Ostan, R., Bucci, L., Pini, E., Nikkïla, J., Monti, D., Satokari, R., Franceschi, C., et al. (2010) · PLoS ONE · doi:10.1371/annotation/df45912f-d15c-44ab-8312-e7ec0607604d · Cited by 345 · see citing works
Fecal Microbiota Composition and Frailty
van Tongeren, S. P., Slaets, J. P. J., Harmsen, H. J. M., & Welling, G. W. (2005) · Applied and Environmental Microbiology · doi:10.1128/aem.71.10.6438-6442.2005 · Cited by 333 · see citing works
“(3) characterized bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by real-time PCR.”
BackgroundResilience of the Dominant Human Fecal Microbiota upon Short-Course Antibiotic Challenge
Cochetiere, M. F. D. L., Durand, T., Lepage, P., Bourreille, A., Galmiche, J. P., & Dore, J. M. (2005) · Journal of Clinical Microbiology · doi:10.1128/jcm.43.11.5588-5592.2005 · Cited by 333 · see citing works
“Oral antibiotic administration profoundly affects the intestinal microbiota (1, 11).”
BackgroundHuman Gut Microbiota: Repertoire and Variations
Lagier, J., Million, M., Hugon, P., Armougom, F., & Raoult, D. (2012) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2012.00136 · Cited by 329 · see citing works
“Antibiotics and total bacterial count According to the literature, oral or intravenous antibiotics tend to decrease the bacterial load in the digestive tracts of infants (Palmer et al., 2007) and elderly patients (Bartosch et al., 2004).”
Mechanisms of Disease: the hygiene hypothesis revisited
Guarner, F., Bourdet‐Sicard, R., Brandtzæg, P., Gill, H. S., McGuirk, P., van Eden, W., Versalovic, J. A., Weinstock, J. V., & Rook, G. A. W. (2006) · Nature Clinical Practice Gastroenterology & Hepatology · doi:10.1038/ncpgasthep0471 · Cited by 315 · see citing works
Louie, T., Cannon, K., Byrne, B., Emery, J., Ward, L., Eyben, M., & Krulicki, W. (2012) · Clinical Infectious Diseases · doi:10.1093/cid/cis338 · Cited by 309 · see citing works
Gorzelak, M. A., Gill, S. K., Tasnim, N., Zahra, A.-V., Jay, M., & Gibson, D. L. (2015) · PLoS ONE · doi:10.1371/journal.pone.0134802 · Cited by 307 · see citing works
The gut microbiome composition associates with bipolar disorder and illness severity
Evans, S. J., Bassis, C. M., Hein, R., Assari, S., Flowers, S. A., Kelly, M., Young, V. B., Ellingrod, V. E., & McInnis, M. G. (2016) · Journal of Psychiatric Research · doi:10.1016/j.jpsychires.2016.12.007 · Cited by 308 · see citing works
“Hospitalized (30) and frail elderly (31), compared to healthy elderly, have lower gut Faecalibacterium.”
Mättö, J., Maunuksela, L., Kajander, K., Palva, A., Korpela, R., Kassinen, A., & Saarela, M. (2005) · FEMS Immunology & Medical Microbiology · doi:10.1016/j.femsim.2004.08.009 · Cited by 301 · see citing works
“Antibiotic therapy can cause disturbances of the intestinal microbiota [38,39], and may affect also the predominant bacterial groups [40].”
BackgroundSensitive Quantitative Detection of Commensal Bacteria by rRNA-Targeted Reverse Transcription-PCR
Matsuda, K., Tsuji, H., Asahara, T., Kado, Y., & Nomoto, K. (2006) · Applied and Environmental Microbiology · doi:10.1128/aem.01224-06 · Cited by 296 · see citing works
“To determine the bacterial population in the human gastrointestinal tract, the applications of qPCR have been expanded (5, 16, 29, 30).”
BackgroundParnell, J. A., & Reimer, R. A. (2011) · British Journal Of Nutrition · doi:10.1017/s0007114511003163 · Cited by 292 · see citing works
Nutrition and the gut microbiome in the elderly
Salazar, N., Valdés-Varela, L., González, S., Gueimonde, M., & de los Reyes-Gavilán, C. G. (2017) · Gut Microbes · doi:10.1080/19490976.2016.1256525 · Cited by 282 · see citing works
Gut bacterial microbiota and obesity
Million, M., Lagier, J., Yahav, D., & Paul, M. (2013) · Clinical Microbiology and Infection · doi:10.1111/1469-0691.12172 · Cited by 287 · see citing works
“Oral and intravenous antibiotics have been reported to decrease the bacterial load in the digestive tract [46,47], although other studies have found that only the microbiota composition is changed [48].”
ResultWalker, A. W., Martin, J. C., Scott, P., Parkhill, J., Flint, H. J., & Scott, K. P. (2015) · Microbiome · doi:10.1186/s40168-015-0087-4 · Cited by 273 · see citing works
Gut microbiota: Changes throughout the lifespan from infancy to elderly
O’Toole, P. W., & Claesson, M. J. (2009) · International Dairy Journal · doi:10.1016/j.idairyj.2009.11.010 · Cited by 279 · see citing works
Ageing and gut microbes: Perspectives for health maintenance and longevity
Biagi, E., Candela, M., Turroni, S., Garagnani, P., Franceschi, C., & Brigidi, P. (2013) · Pharmacological Research · doi:10.1016/j.phrs.2012.10.005 · Cited by 276 · see citing works
Håkansson, Å., Tormo-Badia, N., Baridi, A., Xu, J., Molin, G., Hagslätt, M.-L. J., Karlsson, C., Jeppsson, B. W., Cilio, C., & Ahrné, S. (2014) · Clinical and Experimental Medicine · doi:10.1007/s10238-013-0270-5 · Cited by 263 · see citing works
“plantarum 299v and Escherichia coli CCUG 29300, respectively, using primers listed in Table 1 [19–21].”
MethodThe gut microbiota: A treasure for human health
Li, D., Wang, P., Wang, P., Hu, X., & Chen, F. (2016) · Biotechnology Advances · doi:10.1016/j.biotechadv.2016.08.003 · Cited by 265 · see citing works
“…and was characterized by higher proportions of pathogenic enterobacteria and lower proportions of probiotic Bifidobacteria (Hopkins and Macfarlane, 2002; Woodmansey et al., 2004; Bartosch et al., 2004; Mueller et al., 2006; Claesson et al., 2011; Zwielehner et al., 2009; Mariat et al., 2009).”
BackgroundMatsuda, K., Tsuji, H., Asahara, T., Matsumoto, K., Takada, T., & Nomoto, K. (2009) · Applied and Environmental Microbiology · doi:10.1128/aem.01843-08 · Cited by 261 · see citing works
Food and human gut as reservoirs of transferable antibiotic resistance encoding genes
Rolain, J. (2013) · Frontiers in Microbiology · doi:10.3389/fmicb.2013.00173 · Cited by 258 · see citing works
“It has been shown that the diversity of gut microbiota is reduced after antibiotic therapy in children (Penders et al., 2006) and in elderly patients (Bartosch et al., 2004, 2005).”
BackgroundMäkivuokko, H., Tiihonen, K., Tynkkynen, S., Paulin, L. G., & Rautonen, N. (2009) · British Journal Of Nutrition · doi:10.1017/s0007114509991553 · Cited by 243 · see citing works
The relationship between phenolic compounds from diet and microbiota: impact on human health
Valdés, L., Cuervo, A. J. V., Salazar, N., Ruas‐Madiedo, P., Gueimonde, M., & González, S. (2015) · Food & Function · doi:10.1039/c5fo00322a · Cited by 236 · see citing works
Dubourg, G., Lagier, J., Armougom, F., Robert, C., Audoly, G., Papazian, L., & Raoult, D. (2013) · International Journal of Antimicrobial Agents · doi:10.1016/j.ijantimicag.2012.10.012 · Cited by 235 · see citing works
Ringel-Kulka, T., Cheng, J., Ringel, Y., Salojärvi, J., Carroll, I., Palva, A., de Vos, W. M., & Satokari, R. (2013) · PLoS ONE · doi:10.1371/journal.pone.0064315 · Cited by 230 · see citing works
“qPCR was performed using the SYBRH Green PCR master mix (Applied Biosystems, Carlsbad, CA) with primers that amplify the genes encoding 16S rRNA from Bifidobacterium genus [49] (forward, 59GGGTGGTAATGCCGGATG-39; reverse, 59TAAGCGATGGACTTTCACACC-39) [6].”
MethodWise, M. G. G., & Siragusa, G. R. (2006) · Journal of Applied Microbiology · doi:10.1111/j.1365-2672.2006.03153.x · Cited by 230 · see citing works
Mucosa-Associated Bacterial Diversity in Relation to Human Terminal Ileum and Colonic Biopsy Samples
Ahmed, S., Macfarlane, G. T., Fite, A., McBain, A. J., Gilbert, P., & Macfarlane, S. (2007) · Applied and Environmental Microbiology · doi:10.1128/aem.01143-07 · Cited by 229 · see citing works
“In particular, PCR coupled with denaturing gradient gel electrophoresis (DGGE) has been a useful tool in providing visual fingerprints of the gut microbiota (1, 38, 49), while the more recent development of real-time PCR provides a sensitive and quantitative device for population analysis (5, 10, 15).”
BackgroundMethodSelf-citationSharafedtinov, K. K., Plotnikova, O. A., Исмаиловна, А. Р., Sentsova, T. B., Songisepp, E., Štšepetova, J., Smidt, I., & Mikelsaar, M. (2013) · Nutrition Journal · doi:10.1186/1475-2891-12-138 · Cited by 226 · see citing works
“The purified plasmids were quantified by spectrophotometry (Quibit, Invitrogen) of multiple dilutions [26].”
MethodIntestinal Microbiota Was Assessed in Cirrhotic Patients with Hepatitis B Virus Infection
Lu, H., Wu, Z., Xu, W., Yang, J., Chen, Y., & Li, L. (2011) · Microbial Ecology · doi:10.1007/s00248-010-9801-8 · Cited by 225 · see citing works
“Enterobacteriaceae CATTGACGTTACCCGCAGAAGAAGC 63 [ 2 ]”
BackgroundMethodInfluentialThe Early Settlers: Intestinal Microbiology in Early Life
Scholtens, P. A. M. J., Oozeer, R., Martı́n, R., Amor, K. B., & Knol, J. (2012) · Annual Review of Food Science and Technology · doi:10.1146/annurev-food-022811-101120 · Cited by 220 · see citing works
Association of dietary type with fecal microbiota in vegetarians and omnivores in Slovenia
Matijašić, B. B., Obermajer, T., Lipoglavšek, L., Grabnar, I., Avguštin, G., & Rogelj, I. (2013) · European Journal of Nutrition · doi:10.1007/s00394-013-0607-6 · Cited by 220 · see citing works
The inflammatory status of old age can be nurtured from the intestinal environment
Guigoz, Y., Dore, J. M., & Schiffrin, E. J. (2008) · Current Opinion in Clinical Nutrition & Metabolic Care · doi:10.1097/mco.0b013e3282f2bfdf · Cited by 224 · see citing works
Bruzzese, E., Callegari, M. L., Raia, V., Viscovo, S., Scotto, R., Ferrari, S., Morelli, L., Buccigrossi, V., Vecchio, A. L., Ruberto, E., et al. (2014) · PLoS ONE · doi:10.1371/journal.pone.0087796 · Cited by 217 · see citing works
Age-dependent changes in GI physiology and microbiota: time to reconsider?
An, R., Wilms, E., Masclee, A. A. M., Smidt, H., Zoetendal, E. G., & Jonkers, D. (2018) · Gut · doi:10.1136/gutjnl-2017-315542 · Cited by 209 · see citing works
Site and Strain-Specific Variation in Gut Microbiota Profiles and Metabolism in Experimental Mice
Friswell, M. K., Gika, H., Stratford, I. J., Theodoridis, G., Telfer, B., Wilson, I. D., & McBain, A. J. (2010) · PLoS ONE · doi:10.1371/journal.pone.0008584 · Cited by 207 · see citing works
“…within different strains of mice Fecal samples from six strains of mice (n = 3 of each strain) were subject to Q-PCR using methods as described in Bartosch et al (2004) Primers sets, designed to specifically target lactobacilli, PLoS ONE | www.plosone.org 7 January 2010 | Volume 5 | Issue 1 |…”
MethodOhno, M., Nishida, A., Sugitani, Y., Nishino, K., Inatomi, O., Sugimoto, M., Kawahara, M., & Andoh, A. (2017) · PLoS ONE · doi:10.1371/journal.pone.0185999 · Cited by 211 · see citing works
Carroll, I. M., Chang, Y.-H., Park, J., Sartor, R. B., & Ringel, Y. (2010) · Gut Pathogens · doi:10.1186/1757-4749-2-19 · Cited by 203 · see citing works
The links between the gut microbiome, aging, modern lifestyle and Alzheimer's disease
Askarova, S., Umbayev, B., Masoud, A.-R., Kaiyrlykyzy, A., Safarova, Y., Tsoy, A., Olzhayev, F., & Kushugulova, A. (2020) · Frontiers in Cellular and Infection Microbiology · doi:10.3389/fcimb.2020.00104 · Cited by 208 · see citing works
Tachon, S., Zhou, J., Keenan, M. J., Martin, R. J., & Marco, M. L. (2012) · FEMS Microbiology Ecology · doi:10.1111/j.1574-6941.2012.01475.x · Cited by 206 · see citing works
“…genus level, depletion of specific beneficial gut bacteria such as Bifidobacterium and Akkermansia spp. has been reported for elderly individuals (Bartosch et al., 2004; van Tongeren et al., 2005; Collado et al., 2007; FEMS Microbiol Ecol 83 (2013) 299–309 ª 2012 Federation of European…”
BackgroundPrinciples and applications of polymerase chain reaction in medical diagnostic fields: a review
Valones, M. A. A., Guimarães, R. L., Brandão, L. A. C., de Souza, P. R. E., Carvalho, A. D. A. T., & Crovella, S. (2009) · Brazilian Journal of Microbiology · doi:10.1590/s1517-83822009000100001 · Cited by 203 · see citing works
“There are a considerable number of studies using real-time PCR in the characterization of bacterial communities in the human intestine (6,40,58).”
BackgroundHuman gut microbiota and healthy aging: Recent developments and future prospective
Kumar, M., Babaei, P., Ji, B., & Nielsen, J. (2016) · Nutrition and Healthy Aging · doi:10.3233/nha-150002 · Cited by 201 · see citing works
“Most studies have analyzed variation in the gut microbiota at different stages of host age [69, 72, 73], but there have also been studies on looking into the variability at the individual-level in older subjects [74, 75].”
BackgroundBartosch, S., Woodmansey, E. J., Paterson, J. C. M., McMurdo, M. E. T., & Macfarlane, G. T. (2004) · Clinical Infectious Diseases · doi:10.1086/426027 · Cited by 198 · see citing works
“Old age is often associated with increased ill health, and it is known that detrimental changes in the gut microflora are more prevalent in hospitalized elderly patients than in older people who are healthy, whereas increased use of antibiotics in older members of the community further contributes to degenerative chan…”
BackgroundSelf-citationZwielehner, J., Liszt, K. I., Handschur, M., Laßl, C., Lapin, A., & Haslberger, A. G. (2009) · Experimental Gerontology · doi:10.1016/j.exger.2009.04.002 · Cited by 196 · see citing works
Review: Maternal health and the placental microbiome
Pelzer, E., Gómez-Arango, L. F., Barrett, H. L., & Nitert, M. D. (2016) · Placenta · doi:10.1016/j.placenta.2016.12.003 · Cited by 188 · see citing works
Related actions of probiotics and antibiotics on gut microbiota and weight modification
Angelakis, E., Merhej, V., & Raoult, D. (2013) · The Lancet Infectious Diseases · doi:10.1016/s1473-3099(13)70179-8 · Cited by 190 · see citing works
Gut Microbiome and Antibiotics
Iizumi, T., Battaglia, T., Ruiz, V. E., & Perez, G. I. P. (2017) · Archives of Medical Research · doi:10.1016/j.arcmed.2017.11.004 · Cited by 189 · see citing works
Tan, C., Ling, Z., Huang, Y., Cao, Y.-D., Liu, Q., Cai, T., Yuan, H., Liu, C., Li, Y., & Ke-qian, X. (2015) · Pancreas · doi:10.1097/mpa.0000000000000355 · Cited by 184 · see citing works
The gut microbiota as a novel regulator of cardiovascular function and disease
Battson, M. L., Lee, D. M., Weir, T. L., & Gentile, C. L. (2017) · The Journal of Nutritional Biochemistry · doi:10.1016/j.jnutbio.2017.12.010 · Cited by 185 · see citing works
Humam, A. M., Loh, T. C., Foo, H. L., Samsudin, A. A., Mustapha, N. M., ZULKIFLI, I., & Izuddin, W. I. (2019) · Animals · doi:10.3390/ani9090644 · Cited by 182 · see citing works
“Bifidobacterium F—GGGTGGTAATGCCGGATG 278 [60] R—TAAGCCATGGACTTTCACACC”
Hospitalization type and subsequent severe sepsis
Prescott, H. C., Dickson, R. P., Rogers, M. A. M., Langa, K. M., & Iwashyna, T. J. (2015) · American Journal of Respiratory and Critical Care Medicine · doi:10.1164/rccm.201503-0483oc · Cited by 181 · see citing works
“diversity in hospitalized patients (17, 18).”
BackgroundInter-species transplantation of gut microbiota from human to pigs
Pang, X., Hua, X., Yang, Q., Ding, D., Che, C., Cui, L., Jia, W. P., Bucheli, P., & Zhao, L. (2007) · The ISME Journal · doi:10.1038/ismej.2007.23 · Cited by 179 · see citing works
“Enumeration of bifidobacteria and Bacteroides spp using real-time PCR Plasmid DNA standards for real-time PCR were prepared according to Bartosch et al. (2004).”
MethodHuman gut microbiota: Does diet matter?
Maukonen, J., & Saarela, M. (2015) · Proceedings of The Nutrition Society · doi:10.1017/s0029665114000688 · Cited by 177 · see citing works
“Moreover, when the hospitalisation was combined with antibiotic treatment, reductions in other bacterial groups were also observed((140)).”
Parkinson’s Disease and the Gastrointestinal Microbiome
Lubomski, M., Tan, A. H., Lim, S.-Y., Holmes, A. J., Davis, R. L., & Sue, C. M. (2020) · Journal of Neurology · doi:10.1007/s00415-019-09320-1 · Cited by 172 · see citing works
“Antibiotic therapy affects the diversity of the GM and is associated with reduced abundance of Bifidobacteria, as well as Bacteroides and Prevotella groups [130].”
BackgroundWalton, G., van den Heuvel, E. G. H. M., Kosters, M. H. W., Rastall, R. A., Tuohy, K. M., & Gibson, G. R. (2011) · British Journal Of Nutrition · doi:10.1017/s0007114511004697 · Cited by 173 · see citing works
“Therefore, microbiota in the elderly and young adults have been observed to show alterations that coincide with dietary changes including increased protein intake (16) and activity changes such as reduced exercise levels (17,18) .”
Ecology and metabolism of the beneficial intestinal commensal bacteriumFaecalibacterium prausnitzii
Miquel, S., Martín, R., Bridonneau, C., Robert, V., Sokol, H., Bermúdez‐Humarán, L. G., Thomas, M., & Langella, P. (2014) · Gut Microbes · doi:10.4161/gmic.27651 · Cited by 171 · see citing works
Impact of a synbiotic food on the gut microbial ecology and metabolic profiles
Vitali, B., Ndagijimana, M., Cruciani, F., Carnevali, P., Candela, M., Guerzoni, M. E., & Brigidi, P. (2010) · BMC Microbiology · doi:10.1186/1471-2180-10-4 · Cited by 170 · see citing works
“Real-time PCR enables specific intestinal bacterial populations to be directly quantified by using DNA isolated from fecal material [23,27-29].”
Nourrisson, C., Scanzi, J., Pereira, B., NkoudMongo, C., Wawrzyniak, I., Cian, A., Viscogliosi, É., Livrelli, V., Delbac, F., Dapoigny, M. C., et al. (2014) · PLoS ONE · doi:10.1371/journal.pone.0111868 · Cited by 167 · see citing works
Fernandes, R., Viana, S., Nunes, S., & Reis, F. (2018) · Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease · doi:10.1016/j.bbadis.2018.09.032 · Cited by 172 · see citing works
Unbalance of intestinal microbiota in atopic children
Candela, M., Rampelli, S., Turroni, S., Severgnini, M., Consolandi, C., Bellis, G. D., Masetti, R., Ricci, G., Pession, A., & Brigidi, P. (2012) · BMC Microbiology · doi:10.1186/1471-2180-12-95 · Cited by 166 · see citing works
The gut microbiota of centenarians: Signatures of longevity in the gut microbiota profile
Biagi, E., Rampelli, S., Turroni, S., Quercia, S., Candela, M., & Brigidi, P. (2017) · Mechanisms of Ageing and Development · doi:10.1016/j.mad.2016.12.013 · Cited by 166 · see citing works
Tang, L., Gu, S., Gong, Y., Li, B., Lu, H., Li, Q., Zhang, R., Gao, X., Wu, Z., Zhang, J., et al. (2020) · Engineering · doi:10.1016/j.eng.2020.05.013 · Cited by 166 · see citing works
“q-PCR is fast, easy to use, reliable, and less laborious than second-generation sequencing [31].”
MethodVaughan, E. E., Heilig, H. G. H. J., BENAMOR, K., & DEVOS, W. (2005) · FEMS Microbiology Reviews · doi:10.1016/j.femsre.2005.04.009 · Cited by 186 · see citing works
Hopkins, M. J., Macfarlane, G. T., Furrie, E., Fite, A., & Macfarlane, S. (2005) · FEMS Microbiology Ecology · doi:10.1016/j.femsec.2005.03.001 · Cited by 162 · see citing works
Self-citationFiebiger, U., Bereswill, S., & Heimesaat, M. M. (2016) · European Journal of Microbiology and Immunology · doi:10.1556/1886.2016.00036 · Cited by 160 · see citing works
Increased Prevalence of Methanosphaera stadtmanae in Inflammatory Bowel Diseases
Lecours, P. B., Marsolais, D., Cormier, Y. F., Berberi, M., Haché, C., Bourdages, R., & Duchaine, C. (2014) · PLoS ONE · doi:10.1371/journal.pone.0087734 · Cited by 154 · see citing works
“Limits in DNA extraction approaches and PCR sensitivity in rich microbial environments where inhibitors are present led to a limit of detection (LOD) similar to what we usually observed [46,47,48].”
ResultWei, X., Yan, X., Zou, D., Yang, Z., Wang, X., Liu, W., Wang, S., Li, X., Han, J., Huang, L., et al. (2013) · BMC Gastroenterology · doi:10.1186/1471-230x-13-175 · Cited by 157 · see citing works
“All primer sets used are listed in Table 2 [18-20].”
Maukonen, J., Satokari, R., Mättö, J., Söderlund, H., Mattila-Sandholm, T., & Saarela, M. (2006) · Journal of Medical Microbiology · doi:10.1099/jmm.0.46134-0 · Cited by 156 · see citing works
“... subjects (Table 2). The main difference between the study group of Ma ¨tto ¨ et al. (2005) and the study group in this study was that we did not include subjects who had received antimicrobial therapy during the 2 months prior to the two sampling time-points, since antibiotic therapy can cause disturbances in the…”
ResultAging and the human gut microbiota—from correlation to causality
Saraswati, S., & Sitaraman, R. (2015) · Frontiers in Microbiology · doi:10.3389/fmicb.2014.00764 · Cited by 153 · see citing works
Dubourg, G., Lagier, J., Armougom, F., Robert, C., Hamad, I., Brouqui, P., & Raoult, D. (2013) · European Journal of Clinical Microbiology & Infectious Diseases · doi:10.1007/s10096-012-1787-3 · Cited by 153 · see citing works
“Among the external factors that influence the gut microbiota, it is well known that antibiotics, notably, vancomycin [3] and ciprofloxacin [4], tend to decrease the bacterial load in the digestive tract [5, 6].”
BackgroundEvolution of the Human Diet and Its Impact on Gut Microbiota, Immune Responses, and Brain Health
Olmo, B. M. G., Butler, M. J., & Barrientos, R. M. (2021) · Nutrients · doi:10.3390/nu13010196 · Cited by 154 · see citing works
“Gut microbes do not age, but the incidences of comorbidities associated with gut microbiota tend to increase as the host grows older [37,38].”
BackgroundVaughan, E. E., Heilig, H. G. H. J., Amor, K. B., & de Vos, W. M. (2005) · FEMS Microbiology Reviews · doi:10.1016/j.fmrre.2005.04.009 · Cited by 149 · see citing works
“More recently, real-time quantitative PCR of the 16S rRNA gene is being developed for the detection and quantification of human intestinal bifidobacteria which has the advantages of being high throughput and measuring very low levels of bifidobacteria [48,65,66] (Table 1).”
BackgroundShukla, R., Ghoshal, U., Dhole, T. N., & Ghoshal, U. C. (2015) · Digestive Diseases and Sciences · doi:10.1007/s10620-015-3607-y · Cited by 147 · see citing works
“Patients with IBS (diagnosed using Rome III criteria, n = 47) and HC (n = 30) were comparable in age (mean 34 years [19–68] vs.”
Method
- Authors
- Bartosch, S., Fite, A., Macfarlane, G. T., & McMurdo, M. E. T.
- Affiliations
- University of Dundee (GB)
- MRC Microbiology and Gut Biology Group
- Venue
- Applied and Environmental Microbiology
- Publisher
- American Society for Microbiology
- Published
- 2004-06
- Volume
- 70
- Issue
- 6
- Pages
- 3575-3581
- ISSN
- 0099-2240 (ISSN-L)
- 1098-5336
- PMC
- PMC427772
- OpenAlex
- W2109744701
- Cited by
- 762
- References
- 51
- Citations by year
- 2026: 15 · 2025: 29 · 2024: 12 · 2023: 31 · 2022: 36 · 2021: 51 · 2020: 49 · 2019: 36 · 2018: 38 · 2017: 63 · 2016: 59 · 2015: 65 · 2014: 44 · 2013: 46 · 2012: 46
- FWCI
- 4.63
- Type
- journal article
- Language
- en
- Open access
- green
- europepmc.org
- Locations
- Applied and Environmental Microbiology (publishedVersion)
- Europe PMC (PubMed Central) (publishedVersion)
- PubMed Central (publishedVersion)
- PubMed (publishedVersion)
- Discovery Research Portal (University of Dundee) (submittedVersion)
- Funders
- Medical Research Council
- Topics
- Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › Gut microbiota and health
- Health Sciences › Medicine › Infectious Diseases › Clostridium difficile and Clostridium perfringens research
- Physical Sciences › Environmental Science › Ecology › Microbial Community Ecology and Physiology
- Keywords
- fecal microbiota, older adults, hospitalized patients, antibiotic therapy, Bifidobacterium, Desulfovibrio, Faecalibacterium prausnitzii, 16S rRNA gene quantification, Enterobacteriaceae, Enterococcus faecalis, intestinal bacteria, community-acquired infections
- MeSH terms
- Aged, Aged, 80 and over, Anti-Bacterial Agents, Bacteria, Bacterial Infections, DNA, Bacterial, DNA, Ribosomal, Feces, Hospitalization, Humans, RNA, Ribosomal, 16S, Species Specificity, Polymerase Chain Reaction, Ecosystem, DNA Primers, Gene Dosage, Genes, rRNA
About these checks
Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.
Statistics and arithmetic are recomputed, not judged.
Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.
What counts as a claim ›How we measure confidence ›How we check this ›
Are you an author, or do you see a problem with this page? Request a review
