CoChat
Sign Up
Cited by 279MicroRNA in disease regulationRNA regulation and diseaseRNA Research and Splicing

Cell-Type-Based Analysis of MicroRNA Profiles in the Mouse Brain

Open access
He, Miao, Liu, Yu, Wang, Xiaowo, Zhang, Michael Q., Hannon, Gregory J., Huang, Z. Josh·2012·Neuron
DOI 10.1016/j.neuron.2011.11.010PMC PMC3270494
Open this paper in CoChat — free accountOpen PDF

Abstract

MicroRNAs (miRNA) are implicated in brain development and function but the underlying mechanisms have been difficult to study in part due to the cellular heterogeneity in neural circuits. To systematically analyze miRNA expression in neurons, we have established a miRNA tagging and affinity-purification (miRAP) method that is targeted to cell types through the Cre-loxP binary system in mice. Our studies of the neocortex and cerebellum reveal the expression of a large fraction of known miRNAs with distinct profiles in glutamatergic and GABAergic neurons and subtypes of GABAergic neurons. We further detected putative novel miRNAs, tissue or cell type-specific strand selection of miRNAs, and miRNA editing. Our method thus will facilitate a systematic analysis of miRNA expression and regulation in specific neuron types in the context of neuronal development, physiology, plasticity, pathology, and disease models, and is generally applicable to other cell types and tissues.

AI snapshot

Written from the paper’s full text.

TL;DR

The authors developed miRAP, a Cre-loxP–targeted AGO2 affinity-purification method, to profile microRNAs in genetically defined mouse brain cell types. They report distinct miRNA profiles across glutamatergic, GABAergic, and GABAergic-subtype neurons, plus evidence for novel miRNAs, strand switching, and miRNA editing.

Key findings

  • miRAP profiled five neuron types—cortical Camk2α glutamatergic, Gad2, PV, and SST GABAergic neurons, and cerebellar Purkinje cells—plus neocortex and cerebellum tissue, generating 19 libraries and 291,164,604 raw reads; 99.5% of mapped reads aligned to known miRNA hairpins.
  • The study detected over 480 known miRNAs with distinct cell-type profiles; hierarchical clustering separated neuron types from tissue samples and grouped neocortical GABAergic neurons more closely with cerebellar Purkinje cells than with cortical glutamatergic neurons.
  • Differential expression was widespread: 221/527 detected miRNAs/miRNA* differed between neocortex and cerebellum, 157/523 between Camk2α and Gad2 neurons, and 125/511 between PV and SST neurons (P<0.001), with Taqman PCR validating sequencing results.
  • The authors also detected 23 putative novel miRNAs in the abstract, 18 inferred A-to-I editing sites, and tissue- or cell-type-specific strand selection, such as miR-544-3p versus miR-544-5p and altered miR-299*/miR-485* usage.

Methods

  • miRAP used Rosa26-LSL-tAGO2 mice expressing GFP-MYC-tagged Ago2 after Cre recombination; cell-type-specific Cre drivers targeted tAGO2 to defined neuron populations in P56 mouse neocortex and cerebellum, followed by MYC/AGO2/GFP immunoprecipitation and small RNA deep sequencing on Illumina Genome Analyzer II.
  • Validation included Taqman miRNA PCR normalized to miR-124, FACS sorting of Camk2α cells from a Rosa26-LSL-H2B-GFP reporter line, and northern blotting for candidate novel miRNAs.
  • Sequencing reads were mapped to mouse mm9 and annotated with miRbase v16; differential expression used edgeR with TMM normalization and exact tests, while novel miRNAs were predicted with miRDeep2 and editing sites were called from A-to-G mismatches.

Limitations

  • The paper states that not all neurons of a given class expressed tAgo2, that tag redistribution during homogenization/IP is a potential caveat (though less concerning because AGO2-miRNA binding is stable), and that miRAP versus FACS discrepancies may arise from FACS stress, loss of neurites, RISC-bound versus steady-state miRNAs, and subtype differences.
  • The paper also notes that in situ hybridization with LNA probes did not yield consistent, interpretable results, probably due to low expression of cell-type-specific miRNAs.
  • Evident from the text: cell-type profiles may underrepresent neurons that do not activate tAgo2, and novel miRNA validation was partial—11 candidates gave northern blot signals, and 11 were tested by Taqman PCR, with 7 overlapping between the two sets.

Model-written summary. Check it against the paper before relying on it.

Integrity signals

Registry

Crossref · 10.1016/j.neuron.2011.11.010

Cites

72 of 72 references verified0 citation errors · 0 not checkable

Statistics

Nothing to recompute.

Claims the paper makes

0 of 33 cited sources checked · 0 supported · 0 flagged

  • Findingnone given

    A miRNA tagging and affinity purification method targeted to cell types through the Cre-loxP binary system in mice was established.

    “we have established a miRNA tagging and affinity purification (miRAP) method that is targeted to cell types through the Cre-loxP binary system in mice.”
    Quote in the paperSubstantial claim
  • Findingown data

    A large fraction of known miRNAs is expressed in mouse neocortex and cerebellum.

    “Our studies of the neocortex and cerebellum reveal the expression of a large fraction of known miRNAs with distinct profiles in glutamatergic and GABAergic neurons, and subtypes of GABAergic neurons.”
    Quote in the paperSubstantial claim
  • Findingown data

    23 putative novel miRNAs were detected.

    “Our method further detects 23 putative novel miRNAs and also provides evidence for tissue-specific strand selection of miRNAs and miRNA editing in subset of neuron types.”
    Quote in the paperSubstantial claim
  • Findingown data

    Known miRNAs show distinct expression profiles in glutamatergic and GABAergic neurons, and in subtypes of GABAergic neurons.

    “Our studies of the neocortex and cerebellum reveal the expression of a large fraction of known miRNAs with distinct profiles in glutamatergic and GABAergic neurons, and subtypes of GABAergic neurons.”
    • Also stated in: § INTRODUCTION · plain
      “Our study reveals the expression of a large fraction of known miRNAs (over 480) which show distinct profiles in glutamatergic and GABAergic neurons, and subtypes of GABAergic neurons.”
    Quote in the paperSubstantial claim
  • Findingown data

    In the validation experiment for Camk2α-Cre, expression of miRNAs in two mouse lines harboring different transgenic alleles, LSL-tAgo2 and LSL-H2BGFP, showed the same expression level for the miRNAs examined.

    “in the validation experiment for Camk2α -Cre, the expression of miRNAs in two mouse lines harboring different transgenic allele, i.e. LSL-tAgo2 and LSL-H2BGFP, showed the same expression level for the miRNAs examined.”
    Quote in the paperSubstantial claim
  • May combine two claims. 17
  • Classified as probably not a substantial claim. 17

  • May combine two claims.

    Findingown data

    miR-143 was expressed at relatively high levels in both neocortex and cerebellum but at relatively low levels in all examined neuron types.

    “For example, miR-143 was expressed at relatively high levels in both neocortex and cerebellum (ranking at 30 and 51 respectively, from highest to lowest, average normalized per million reads number > 10,000 ), but expressed at relatively low levels in all the examined neuron types (ranking after 160, average normalized per million reads number <500, pairwise fold-change > 20, P<10−84) (Sppl Table”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingown data

    tAGO2 predominantly localized to the cytoplasm in neuronal somata, but was also detected in neurites, with a particularly prominent example in the dendritic tree of Purkinje cells.

    “tAGO2 predominantly localized to the cytoplasm in neuronal somata, but was also detected in neurites, with a particularly prominent example in the dendritic tree of Purkinje cells (Figure 2).”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Findingown data

    In total, 19 libraries and 291,164,604 raw reads were generated.

    “In total, we generated19 libraries and 291,164,604 raw reads.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Findingown data

    A 100kD endogenous AGO2 band was detected in whole brain homogenates from both tAgo2 and LSL-tAgo2 mice, while the higher molecular weight tAGO2 band was detected only in the tAgo2 sample.

    “Using antibody against AGO2, a 100kD endogenous band was detected in whole brain homogenates from both the tAgo2 and LSL-tAgo2 mouse, while the higher molecular weight tAGO2 band is only detected in tAgo2 sample (Figure 1C).”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Findingreasoning

    The study's extensive effort to validate RNA expression by in situ hybridization using LNA probes did not yield consistent and interpretable results, probably due to relatively low expression of cell type specific miRNAs.

    “Unfortunately, our extensive effort did not yield consistent and interpretable results, probably due to the relatively low expression of cell type specific miRNAs.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S2 (checkable), S4 (based). May combine two claims.

    Premisenone given

    Individual cell types are the building blocks of neural circuits and the basic units of gene regulation.

    “because individual cell types are the building blocks of neural circuits as well as the basic units of gene regulation.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Interpretationreasoning

    The tag redistribution issue is inherent to the tag and IP procedure itself and thus is common to all datasets; it would reduce the observed magnitude of differential expression among cell types.

    “This issue is inherent to the tag and IP procedure itself and thus is common to all datasets; it would reduce the observed magnitude of differential expression among cell types.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Interpretationown data

    The hierarchical clustering result demonstrates the necessity and power of cell type based analysis.

    “This result demonstrates the necessity and power of cell type based analysis.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Interpretationcitation

    miRAP should capture miRNAs in neurites because AGO2 localizes in dendrites and tAGO2 signal can be detected in dendrites.

    “miRAP, on the other hand, should capture miRNAs in neurites since AGO2 has been shown to localize in dendtrites (Cougot et al., 2008, Lugli et al., 2005) and tAGO2 signal can be detected in dendrites (Figure 3).”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites Cougot et al., 2008 source
    • cites Lugli et al., 2005 source

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    Ago HITS-CLIP has been used to profile miRNA-mRNA targets in the mouse brain.

    “Recently, Ago HITS-CLIP has been used to profile miRNA-mRNA targets in the mouse brain (Chi et al., 2009).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites Chi et al., 2009 source

      Not checked in the free run.

  • May combine two claims.

    Study design and conductown data

    Although not all neurons of a given class expressed tAgo2, almost all GFP+ cells colocalized with corresponding cell type markers, proving highly stringent specificity of the system.

    “Although not all neurons of a given classes expressed tAgo2, almost all GFP+ cells colocalized with corresponding cell type markers, proving the highly stringent specificity of our system.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    Radiolabeled synthetic RNA oligos were spiked into small RNA libraries and retained as a spike-in oligo control for RNA editing analysis.

    “Radiolabeled synthetic RNA oligos (M19: CGUACGGUUUAAACUUCGA and M24: CGUACGGUUUAAACUUCGAAAUGU) were spiked in to trace RNA on UREA-PAGE during library preparation, and were depleted by PmelI digestion after PCR amplification. Significant amount of oligos were retained in the libraries, and were used as spike-in oligo control for RNA editing analysis.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductnone given

    All miRNA Taqman PCR reactions were run in triplicate.

    “All reactions were run in triplicate.”
    Quote in the paperNot a substantial claim

  • May combine two claims.

    Interpretationreasoning

    Profiles from miRAP likely represent active miRNAs associated with Ago2, while miRNA extraction from sorted cells harvests steady state miRNAs regardless of functional status.

    “Profiles from miRAP likely represent “active” miRNAs which are associated with Ago2, while miRNA extraction from sorted cells harvests steady state miRNAs regardless of their functional status.”
    Quote in the paperSubstantial claim
    • Rests on an assumption: Not all mature miRNAs are incorporated into the RISC complex.

  • May combine two claims.

    Study design and conductown data

    The correlation coefficient of miRNA profiles from biological replicates within a group was extremely high (>0.96), indicating high reproducibility of the miRAP method.

    “In our experiments, the correlation coefficient of miRNA profiles from biological replicates within a group (the same cell or tissue type) were extremely high (>0.96, Sppl Table 1), indicating the high reproducibility of the miRAP method.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Premisecitation

    miRNAs can influence transcription by regulating the translation of transcriptional factors.

    “miRNAs can also influence transcription by regulating the translation of transcriptional factors (Hobert, 2008).”
    Quote in the paperNot a substantial claim0 of 1 sources checked
    • cites Hobert, 2008 source

  • Classified as probably not a substantial claim. May combine two claims.

    Study design and conductown data

    The same data sets were randomly shuffled 10,000 times and processed under the same procedure; the P-value for the actual data set was set to 0.001 as the cutoff to report differential expression of miRNAs.

    “The same data sets were randomly shuffled 10,000 times, and then processed under the same procedure. According to this result, P-value for the actual data set was set to 0.001 as the cutoff to report differentia expression of miRNAs.”
    Quote in the paperSubstantial claim

  • May combine two claims.

    Premisecitation

    FACS sorted neurons only retain cell body whereas most of their neuronal processes are lost, along with miRNAs localized in dendrites and synapses.

    “FACS sorted neurons only retain cell body whereas most of their neuronal processes are lost, along with the miRNAs that are localized in dendrites (Tai and Schuman, 2006) and synapses (Schratt, 2009, Lugli et al., 2008).”
    Quote in the paperSubstantial claim0 of 3 sources checked
    • cites Tai and Schuman, 2006 source
    • cites Schratt, 2009 source
    • cites Lugli et al., 2008 source

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisecitation

    miRNAs regulate the stability and translation of mRNAs.

    “In addition to gene transcription which dictates mRNA production, the stability and translation of mRNAs are regulated by microRNAs (miRNAs), the class of 20~23nt small noncoding RNAs (He and Hannon, 2004, Bartel, 2004).”
    Quote in the paperNot a substantial claim0 of 2 sources checked
    • cites He and Hannon, 2004 source
    • cites Bartel, 2004 source

  • Classified as probably not a substantial claim.

    Premisecitation

    AGO2 is indispensable for Dicer-independent miRNA biogenesis.

    “Among the four members in the AGO family in human and mouse, only AGO2 exhibits endoneuclase activity (Meister et al., 2004, Ikeda et al., 2006) and is indispensible for Dicer-independent miRNA biogenesis (Cheloufi et al., 2010).”
    Quote in the paperSubstantial claim0 of 1 sources checked
    • cites Cheloufi et al., 2010 source

  • Classified as probably not a substantial claim.

    Study design and conductnone given

    Only miRNAs with unique precursor and five or more reads on either arm in at least 10 libraries were considered and reported for arm switching.

    “Only miRNAs with unique precursor and five or more reads on either arm in at least 10 libraries were considered and reported.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S2 (checkable).

    Premisereasoning

    A necessary step is comprehensive characterization of miRNA expression profiles at the level of distinct neuron types.

    “A necessary step is a comprehensive characterization of miRNA expression profiles at the level of distinct neuron types, because individual cell types are the building blocks of neural circuits as well as the basic units of gene regulation.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Premisereasoning

    A comprehensive understanding of gene expression profiles in defined cell types provides a molecular explanation of cell phenotypes.

    “Therefore, a comprehensive understanding of gene expression profiles in defined cell types not only provides a molecular explanation of cell phenotypes but also is necessary for establishing the link from gene function to neural circuit organization and dynamics.”
    Quote in the paperSubstantial claim

  • Probably not a substantial claim: may not pass S2 (checkable).

    Premisereasoning

    A comprehensive understanding of gene expression profiles in defined cell types is necessary for establishing the link from gene function to neural circuit organization and dynamics.

    “Therefore, a comprehensive understanding of gene expression profiles in defined cell types not only provides a molecular explanation of cell phenotypes but also is necessary for establishing the link from gene function to neural circuit organization and dynamics.”
    Quote in the paperNot a substantial claim

  • Probably not a substantial claim: may not pass S3 (load-bearing).

    Study design and conductown data

    All PCR positive ES cell clones were also positive for southern blot.

    “All PCR positive clones were also positive for southern blot.”
    Quote in the paperNot a substantial claim

  • Classified as probably not a substantial claim.

    Premisecitation

    AGO immunoprecipitation has been successfully used to isolate miRNAs and their mRNA targets.

    “AGO immunoprecipitation has been successfully used to isolate miRNAs and their mRNA targets (Easow et al., 2007, Beitzinger et al., 2007, Hendrickson et al., 2008, Zhang et al., 2007, Hammell et al., 2008, Karginov et al., 2007).”
    Quote in the paperSubstantial claim0 of 3 sources checked
    • cites Easow et al., 2007 source
    • cites Beitzinger et al., 2007 source
    • cites Hendrickson et al., 2008 source

  • Probably not a substantial claim: may not pass S3 (load-bearing). May combine two claims.

    Premisecitation

    Recent studies reveal diverse roles of miRNAs in the brain, including neural patterning, neural stem cell differentiation, cell type specification, synaptic plasticity, and neuropsychiatric disorders.

    “Recent studies begin to reveal diverse role of miRNAs in the brain, such as in neural patterning (Ronshaugen et al., 2005), neural stem cell differentiation (Kuwabara et al., 2004), cell type specification (Poole and Hobert, 2006), synaptic plasticity (Schratt et al., 2006), and also in neuropsychiatric disorders (Shafi et al., 2010, Xu et al., 2010a).”
    Quote in the paperNot a substantial claim0 of 3 sources checked
    • cites Ronshaugen et al., 2005 source
    • cites Kuwabara et al., 2004 source
    • cites Poole and Hobert, 2006 source

  • May combine two claims.

    Premisecitation

    Genetic tagging methods such as TRAP and Ribo-tag begin to overcome obstacles of physical enrichment but are limited to the analysis of mRNA expression.

    “The recent invention of genetic tagging methods, such as TRAP (Heiman et al., 2008b) and Ribo-tag (Sanz et al., 2009), begin to overcome these obstacles, but these strategies have been limited to the analysis of mRNA expression.”
    Quote in the paperSubstantial claim0 of 2 sources checked
    • cites Heiman et al., 2008b

      Couldn’t be matched to a paper in Crossref, so it can’t be checked.

    • cites Sanz et al., 2009 source

  • Probably not a substantial claim: may not pass S3 (load-bearing), S4 (based). May combine two claims.

    Interpretationnone given

    Within each major GLU and GABAergic neuron type in the study, subtypes likely express tAgo2 at different levels and show different miRNA expression and regulation, including their response to stress and physical damage during FACS.

    “Finally, within each major GLU and GABAergic neurons in our study, subtypes likely express tAgo2 at different levels and show different miRNA expression and regulation, including their response to stress and physical damage during FACS.”
    Quote in the paperNot a substantial claim
29 of 29

  • The paper relies on this without support.

    The role of miRNAs in brain development, function, and plasticity remains poorly understood.

    “Despite their prominent expression in the mammalian brain, the role of miRNAs in brain development, function, and plasticity remains poorly understood.”

  • The paper relies on this without support.

    A major challenge is to link miRNA activity in defined neuron types to specific aspects of neuronal specification, development and physiology.

    “A major challenge is to link miRNA activity in defined neuron types to specific aspects of neuronal specification, development and physiology; characterizing miRNA profiles in specific cell types is the first step.”

  • The paper relies on this without support.

    Not all mature miRNAs are incorporated into the RISC complex.

    “Third, not all mature miRNAs are incorporated into RISC complex.”

  • The paper relies on this without support.

    miRNA activity requires base-pairing with only 6–8 nucleotides of mRNA.

    “As miRNA activity requires base-pairing with only 6–8 nucleotides of mRNA, target prediction through bioinformatics has proven to be challenging.”
4 of 4

Claims other papers make about this one

Each is checked against this paper’s own text: does it say what the citing paper says it does?

  • Most scRNA-seq protocols rely on poly(T) priming to capture polyadenylated mRNAs, whereas most miRs and all tRFs are not polyadenylated.

    “Additionally, most scRNA-seq protocols rely on poly(T) priming to capture polyadenylated mRNAs, whereas most miRs and all tRFs are not polyadenylated 29 .”

    From Human brain microRNAs exhibit cell-type specificity and age dependence (2026) · cites this paper as [29]

  • He et al. developed a tool for genetic expression of a tagged Argonaute-2 in mice, characterizing miRNA expression in several neuronal cell types in cortex and cerebellum.

    “He et al. developed a tool for genetic expression of a tagged Argonaute-2 in mice, characterizing miRNA expression in several neuronal cell types in cortex and cerebellum9.”

    From CNS microRNA profiles: a database for cell type enriched microRNA expression across the mouse central nervous system (2020) · cites this paper as [9]

Cites

Flagged first, then by citations

Research works printed but not linked: 1

  1. Heiman, 2008, A translational profiling approach for the molecular characterization of CNS cell types, Cell, 135, 738, 10.1016/j.cell.2008.10.028 · DOI · Paper page

Cited by

Sorted by citations

Related

Authors
He, M., Liu, Y., Wang, X., Zhang, M. Q., Hannon, G. J., & Huang, Z. J.
Affiliations
  • Cold Spring Harbor Laboratory (US)
  • Tsinghua University (CN)
  • The University of Texas at Dallas (US)
Corresponding author
Huang, Z. Josh
ORCID
Venue
Neuron
Publisher
Elsevier BV
Published
2012-01
Volume
73
Issue
1
Pages
35-48
ISSN
0896-6273 (ISSN-L)
DOI
10.1016/j.neuron.2011.11.010
PMC
PMC3270494
OpenAlex
W2105336002
Cited by
277
References
72
Citations by year
2026: 12 · 2025: 13 · 2024: 22 · 2023: 21 · 2022: 14 · 2021: 17 · 2020: 20 · 2019: 16 · 2018: 23 · 2017: 25 · 2016: 22 · 2015: 19 · 2014: 20 · 2013: 26 · 2012: 7
FWCI
7.42
Type
journal article
Language
en
Update notices
erratum (2012-02-09)
Open access
Licence
Locations
  • Neuron (publishedVersion)
  • PubMed (publishedVersion)
  • Europe PMC (PubMed Central) (acceptedVersion)
  • PubMed Central (acceptedVersion)
  • Cold Spring Harbor Laboratory Institutional Repository (Cold Spring Harbor Laboratory) (acceptedVersion)
Funders
National Natural Science Foundation of China (31061160497, 60905013, 91019016)
Topics
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Cancer Research › MicroRNA in disease regulation
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA regulation and disease
  • Life Sciences › Biochemistry, Genetics and Molecular Biology › Molecular Biology › RNA Research and Splicing
Keywords
miRNA expression profiling, Cre-loxP system, glutamatergic neurons, GABAergic neurons, neocortex, cerebellum, novel miRNAs, mouse brain
MeSH terms
Animals, Brain, Chromosome Mapping, Flow Cytometry, Mice, Inbred C57BL, Mice, Transgenic, Models, Molecular, Neurons, RNA Editing, Microscopy, Confocal, Oligonucleotide Array Sequence Analysis, Gene Expression Profiling, MicroRNAs, Green Fluorescent Proteins, Mice, Calcium-Calmodulin-Dependent Protein Kinase Type 2, Argonaute Proteins

About these checks

Registry, retraction, Cites and statistics results are computed, not judged, with one exception: a printed reference that no index lists is read once by a model before it counts as a citation error. Claims are extracted by a model and kept only when their quote appears verbatim in the text; each cited source is then checked, with a model’s help, for whether it says what the claim relies on. Those verdicts can be wrong — read the claim’s quote and the cited source before relying on one.

Claims read by deepseek-v4.1-flash under definition version 3 (extract-v3) on 2026-11-06.

Classified by jev-1.13-20260917 (gold-guideline-v0.2) on 2026-11-06.

Statistics and arithmetic are recomputed, not judged.

Confidence bands are shown only for fields calibrated on our annotated test set. None is calibrated yet, so no band is shown.

What counts as a claim ›How we measure confidence ›How we check this ›

Are you an author, or do you see a problem with this page? Request a review